Incidental Mutation 'R4248:Cdh9'
ID 320507
Institutional Source Beutler Lab
Gene Symbol Cdh9
Ensembl Gene ENSMUSG00000025370
Gene Name cadherin 9
Synonyms T1-cadherin
MMRRC Submission 041064-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R4248 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 16728842-16857180 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 16850474 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 536 (F536L)
Ref Sequence ENSEMBL: ENSMUSP00000154022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026432] [ENSMUST00000228307]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000026432
AA Change: F536L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000026432
Gene: ENSMUSG00000025370
AA Change: F536L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 75 156 2.84e-15 SMART
CA 180 265 5.63e-28 SMART
CA 289 381 1.12e-13 SMART
CA 404 485 8.03e-24 SMART
CA 508 595 1.34e-2 SMART
transmembrane domain 613 635 N/A INTRINSIC
Pfam:Cadherin_C 638 782 1.5e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227900
Predicted Effect probably benign
Transcript: ENSMUST00000228307
AA Change: F536L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.3734 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II classical cadherin from the cadherin superfamily, integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. The extracellular domain consists of 5 subdomains, each containing a cadherin motif, and appears to determine the specificity of the protein's homophilic cell adhesion activity. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout results in the formation of abnormal axonal arbors in some retinal type 5 bipolar cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,606,013 (GRCm39) N36S possibly damaging Het
Alox12b G A 11: 69,054,431 (GRCm39) V250I probably benign Het
Armt1 T C 10: 4,389,687 (GRCm39) F115L probably benign Het
Fbxo25 T C 8: 13,989,617 (GRCm39) S355P probably damaging Het
Fhod3 A G 18: 25,123,123 (GRCm39) K271R probably null Het
Gapt C A 13: 110,490,289 (GRCm39) V125F probably damaging Het
Gucd1 A T 10: 75,345,662 (GRCm39) V131E probably damaging Het
Hecw2 C T 1: 53,871,804 (GRCm39) V1381M probably damaging Het
Hivep2 A G 10: 14,007,299 (GRCm39) E1299G probably damaging Het
Hnf4g A G 3: 3,717,909 (GRCm39) D342G possibly damaging Het
Kmt2b C T 7: 30,273,489 (GRCm39) R2349H probably benign Het
Lama5 C T 2: 179,822,220 (GRCm39) R2896Q possibly damaging Het
Moxd2 A C 6: 40,855,933 (GRCm39) I552S probably damaging Het
Nkx1-2 TGGTGAGAGGGGGCCGCCTTGGCCCCG TG 7: 132,201,209 (GRCm39) probably null Het
Onecut3 A G 10: 80,349,963 (GRCm39) T486A possibly damaging Het
Or8g36 A G 9: 39,422,899 (GRCm39) V39A probably benign Het
Pik3cb T C 9: 98,983,229 (GRCm39) probably null Het
Pirb A G 7: 3,722,297 (GRCm39) F182S probably damaging Het
Rev1 C T 1: 38,146,729 (GRCm39) R34H possibly damaging Het
Satl1 A G X: 111,316,033 (GRCm39) S141P probably benign Het
Setx GTGGCT GT 2: 29,044,073 (GRCm39) 1814 probably null Het
Snx8 A G 5: 140,341,800 (GRCm39) L121P probably damaging Het
Tep1 T C 14: 51,100,351 (GRCm39) H389R possibly damaging Het
Tnfrsf1b G A 4: 144,942,535 (GRCm39) A416V probably benign Het
Ust A T 10: 8,393,982 (GRCm39) L61Q possibly damaging Het
Vmn2r101 A T 17: 19,809,376 (GRCm39) K168N probably damaging Het
Other mutations in Cdh9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Cdh9 APN 15 16,828,448 (GRCm39) missense probably damaging 1.00
IGL00555:Cdh9 APN 15 16,823,492 (GRCm39) missense probably damaging 1.00
IGL01110:Cdh9 APN 15 16,856,012 (GRCm39) missense possibly damaging 0.63
IGL01432:Cdh9 APN 15 16,831,033 (GRCm39) missense probably damaging 1.00
IGL01768:Cdh9 APN 15 16,778,311 (GRCm39) missense possibly damaging 0.51
IGL02043:Cdh9 APN 15 16,856,318 (GRCm39) missense probably damaging 1.00
IGL02304:Cdh9 APN 15 16,848,687 (GRCm39) missense probably benign 0.01
IGL02380:Cdh9 APN 15 16,856,086 (GRCm39) missense possibly damaging 0.79
IGL02505:Cdh9 APN 15 16,856,075 (GRCm39) missense probably damaging 1.00
IGL02675:Cdh9 APN 15 16,849,162 (GRCm39) splice site probably null
IGL02679:Cdh9 APN 15 16,832,316 (GRCm39) missense probably damaging 0.97
IGL03288:Cdh9 APN 15 16,856,135 (GRCm39) missense probably damaging 1.00
R0426:Cdh9 UTSW 15 16,823,540 (GRCm39) critical splice donor site probably null
R0726:Cdh9 UTSW 15 16,831,130 (GRCm39) missense probably benign 0.00
R1335:Cdh9 UTSW 15 16,850,878 (GRCm39) missense probably benign 0.00
R1368:Cdh9 UTSW 15 16,848,568 (GRCm39) splice site probably benign
R1766:Cdh9 UTSW 15 16,778,392 (GRCm39) missense probably damaging 1.00
R1916:Cdh9 UTSW 15 16,823,361 (GRCm39) missense probably benign 0.03
R2325:Cdh9 UTSW 15 16,778,286 (GRCm39) missense probably benign
R2424:Cdh9 UTSW 15 16,850,440 (GRCm39) missense probably damaging 1.00
R3104:Cdh9 UTSW 15 16,855,900 (GRCm39) missense probably damaging 1.00
R3837:Cdh9 UTSW 15 16,823,524 (GRCm39) nonsense probably null
R3839:Cdh9 UTSW 15 16,823,524 (GRCm39) nonsense probably null
R4241:Cdh9 UTSW 15 16,849,165 (GRCm39) critical splice acceptor site probably null
R4576:Cdh9 UTSW 15 16,832,325 (GRCm39) missense possibly damaging 0.73
R4679:Cdh9 UTSW 15 16,851,045 (GRCm39) missense probably benign
R4896:Cdh9 UTSW 15 16,778,242 (GRCm39) missense probably benign 0.12
R4961:Cdh9 UTSW 15 16,850,914 (GRCm39) missense probably benign
R5050:Cdh9 UTSW 15 16,778,233 (GRCm39) missense probably benign 0.12
R5089:Cdh9 UTSW 15 16,778,362 (GRCm39) missense probably damaging 1.00
R5268:Cdh9 UTSW 15 16,851,099 (GRCm39) missense probably benign
R5567:Cdh9 UTSW 15 16,855,930 (GRCm39) missense probably damaging 1.00
R5646:Cdh9 UTSW 15 16,823,371 (GRCm39) missense probably damaging 1.00
R5894:Cdh9 UTSW 15 16,832,186 (GRCm39) missense possibly damaging 0.47
R6440:Cdh9 UTSW 15 16,823,509 (GRCm39) missense probably benign 0.01
R6441:Cdh9 UTSW 15 16,823,509 (GRCm39) missense probably benign 0.01
R7225:Cdh9 UTSW 15 16,856,159 (GRCm39) missense probably damaging 1.00
R7247:Cdh9 UTSW 15 16,778,341 (GRCm39) missense probably damaging 1.00
R7593:Cdh9 UTSW 15 16,823,261 (GRCm39) missense probably damaging 1.00
R7615:Cdh9 UTSW 15 16,856,316 (GRCm39) missense probably damaging 1.00
R7632:Cdh9 UTSW 15 16,851,115 (GRCm39) splice site probably null
R7991:Cdh9 UTSW 15 16,828,489 (GRCm39) missense probably damaging 1.00
R8035:Cdh9 UTSW 15 16,831,152 (GRCm39) missense probably damaging 0.97
R8834:Cdh9 UTSW 15 16,850,964 (GRCm39) missense probably damaging 1.00
R8909:Cdh9 UTSW 15 16,848,610 (GRCm39) missense probably damaging 1.00
R8936:Cdh9 UTSW 15 16,831,162 (GRCm39) critical splice donor site probably null
R8973:Cdh9 UTSW 15 16,831,131 (GRCm39) missense possibly damaging 0.78
R9138:Cdh9 UTSW 15 16,823,273 (GRCm39) missense probably damaging 1.00
R9305:Cdh9 UTSW 15 16,832,138 (GRCm39) missense probably damaging 1.00
RF006:Cdh9 UTSW 15 16,855,916 (GRCm39) missense probably damaging 0.97
X0062:Cdh9 UTSW 15 16,848,625 (GRCm39) missense possibly damaging 0.81
Z1177:Cdh9 UTSW 15 16,850,450 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ACCCACACAGTTCTCTTCAG -3'
(R):5'- TCGACCTCATTAATATGGGCAATTG -3'

Sequencing Primer
(F):5'- TGTGACCCCAATAAGATGTGC -3'
(R):5'- TGGGCAATTGAACTTGTACATG -3'
Posted On 2015-06-12