Incidental Mutation 'R4249:Kansl1l'
ID320516
Institutional Source Beutler Lab
Gene Symbol Kansl1l
Ensembl Gene ENSMUSG00000026004
Gene NameKAT8 regulatory NSL complex subunit 1-like
Synonyms1110028C15Rik, C430010P07Rik
MMRRC Submission 041065-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R4249 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location66719248-66817562 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 66773478 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 459 (D459N)
Ref Sequence ENSEMBL: ENSMUSP00000063843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068168] [ENSMUST00000113987]
Predicted Effect probably damaging
Transcript: ENSMUST00000068168
AA Change: D459N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063843
Gene: ENSMUSG00000026004
AA Change: D459N

DomainStartEndE-ValueType
low complexity region 340 355 N/A INTRINSIC
low complexity region 491 507 N/A INTRINSIC
low complexity region 518 535 N/A INTRINSIC
PEHE 755 875 2.42e-33 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113987
AA Change: D459N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109620
Gene: ENSMUSG00000026004
AA Change: D459N

DomainStartEndE-ValueType
low complexity region 340 355 N/A INTRINSIC
low complexity region 491 507 N/A INTRINSIC
low complexity region 518 535 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000129190
AA Change: D114N
SMART Domains Protein: ENSMUSP00000118603
Gene: ENSMUSG00000026004
AA Change: D114N

DomainStartEndE-ValueType
low complexity region 31 46 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
low complexity region 174 191 N/A INTRINSIC
PEHE 455 575 2.42e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195411
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195562
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
Ankrd39 A G 1: 36,547,155 S11P probably benign Het
Aox2 A G 1: 58,299,819 S324G probably benign Het
Atl3 T C 19: 7,532,338 V477A probably benign Het
Bcar1 T C 8: 111,720,893 T151A probably benign Het
Cdc42bpg A G 19: 6,315,266 T718A possibly damaging Het
Col9a1 C T 1: 24,244,381 R843C probably damaging Het
Dnah12 T A 14: 26,709,186 D316E possibly damaging Het
Fat2 A G 11: 55,284,301 V1862A probably damaging Het
Fbxw5 C A 2: 25,503,460 N233K probably damaging Het
Fcer2a A G 8: 3,688,831 F75L probably benign Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Gimd1 T C 3: 132,644,408 V144A possibly damaging Het
Glt1d1 T C 5: 127,691,112 probably null Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Muc4 T C 16: 32,755,826 probably benign Het
Myom1 T A 17: 71,092,140 V999E probably damaging Het
Nckap5 A G 1: 126,027,639 L460P probably benign Het
Olfr109 T C 17: 37,466,824 M206T probably damaging Het
Phf13 A T 4: 151,992,095 N213K probably damaging Het
Phldb3 T C 7: 24,627,320 I591T probably damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Plekhh2 A G 17: 84,586,337 E860G possibly damaging Het
Rest A G 5: 77,282,112 T793A probably benign Het
Ropn1 C T 16: 34,678,456 Q205* probably null Het
Sacs A C 14: 61,203,457 K984T probably benign Het
Samd11 G A 4: 156,250,486 R102C probably damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Shank1 C A 7: 44,319,736 H352N unknown Het
Slc22a27 A T 19: 7,925,879 I162K possibly damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Tln1 A T 4: 43,536,104 V2027E probably damaging Het
Trdn A G 10: 33,450,998 I594M probably benign Het
Trim5 C G 7: 104,276,815 E180Q possibly damaging Het
Tsen2 A G 6: 115,547,824 probably benign Het
Tubb1 A T 2: 174,455,733 E45V probably null Het
Vmn2r67 T A 7: 85,150,514 probably null Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 121,604,292 probably benign Het
Zfp160 T A 17: 21,025,738 F183L probably benign Het
Other mutations in Kansl1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Kansl1l APN 1 66724574 missense possibly damaging 0.83
IGL00825:Kansl1l APN 1 66801512 missense probably benign
IGL01644:Kansl1l APN 1 66801316 missense probably benign 0.01
IGL01690:Kansl1l APN 1 66801073 missense probably damaging 0.98
IGL01811:Kansl1l APN 1 66723303 missense probably damaging 1.00
IGL01966:Kansl1l APN 1 66738068 missense probably damaging 1.00
IGL02549:Kansl1l APN 1 66801968 missense probably benign 0.44
IGL02578:Kansl1l APN 1 66801689 nonsense probably null
IGL02707:Kansl1l APN 1 66773445 missense probably damaging 1.00
IGL03088:Kansl1l APN 1 66735725 missense probably damaging 0.98
IGL03187:Kansl1l APN 1 66725903 missense probably damaging 1.00
IGL03279:Kansl1l APN 1 66735666 missense probably damaging 0.99
arkansasii UTSW 1 66762103 missense probably damaging 1.00
Kansasii UTSW 1 66778106 missense probably null 0.41
PIT4810001:Kansl1l UTSW 1 66762149 missense probably damaging 1.00
R0068:Kansl1l UTSW 1 66720888 missense probably benign 0.00
R0068:Kansl1l UTSW 1 66720888 missense probably benign 0.00
R0070:Kansl1l UTSW 1 66801103 missense probably damaging 0.99
R0312:Kansl1l UTSW 1 66778106 missense probably null 0.41
R0456:Kansl1l UTSW 1 66735726 missense probably damaging 0.99
R0720:Kansl1l UTSW 1 66801356 missense possibly damaging 0.52
R1381:Kansl1l UTSW 1 66720904 missense probably benign 0.01
R1470:Kansl1l UTSW 1 66801997 missense possibly damaging 0.82
R1470:Kansl1l UTSW 1 66801997 missense possibly damaging 0.82
R1759:Kansl1l UTSW 1 66801888 missense probably damaging 0.96
R1840:Kansl1l UTSW 1 66778032 missense probably damaging 1.00
R2299:Kansl1l UTSW 1 66773477 missense probably damaging 1.00
R2888:Kansl1l UTSW 1 66724605 missense probably benign 0.13
R2893:Kansl1l UTSW 1 66801334 missense probably damaging 1.00
R3735:Kansl1l UTSW 1 66801250 missense possibly damaging 0.90
R4448:Kansl1l UTSW 1 66738159 missense probably damaging 0.99
R4710:Kansl1l UTSW 1 66801496 missense possibly damaging 0.66
R4768:Kansl1l UTSW 1 66801133 missense probably damaging 1.00
R5523:Kansl1l UTSW 1 66802112 missense probably benign 0.00
R5645:Kansl1l UTSW 1 66801344 missense probably benign 0.27
R5840:Kansl1l UTSW 1 66770215 intron probably benign
R5964:Kansl1l UTSW 1 66725922 missense probably damaging 1.00
R5990:Kansl1l UTSW 1 66735726 missense probably damaging 0.98
R6009:Kansl1l UTSW 1 66735600 missense probably benign 0.00
R6051:Kansl1l UTSW 1 66726726 missense probably null 1.00
R6092:Kansl1l UTSW 1 66773484 missense probably damaging 1.00
R6316:Kansl1l UTSW 1 66735585 missense probably benign
R6402:Kansl1l UTSW 1 66762193 missense probably damaging 0.99
R6906:Kansl1l UTSW 1 66723278 missense possibly damaging 0.76
R7241:Kansl1l UTSW 1 66801628 missense possibly damaging 0.91
R7434:Kansl1l UTSW 1 66762103 missense probably damaging 1.00
R7716:Kansl1l UTSW 1 66801133 missense probably damaging 1.00
R7793:Kansl1l UTSW 1 66778014 missense probably damaging 1.00
R8187:Kansl1l UTSW 1 66801737 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AATCTCTCAGGATCTAAATGACCC -3'
(R):5'- GGATAGTAGGATGTGATCACTTTACTG -3'

Sequencing Primer
(F):5'- CCTCAAGAGCTGGGATTATGACC -3'
(R):5'- TTTTTACCCCCTAGGGGA -3'
Posted On2015-06-12