Incidental Mutation 'R4249:Fbxw5'
ID320518
Institutional Source Beutler Lab
Gene Symbol Fbxw5
Ensembl Gene ENSMUSG00000015095
Gene NameF-box and WD-40 domain protein 5
SynonymsFbw5
MMRRC Submission 041065-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.373) question?
Stock #R4249 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location25500750-25505471 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 25503460 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 233 (N233K)
Ref Sequence ENSEMBL: ENSMUSP00000015239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015227] [ENSMUST00000015239] [ENSMUST00000040042] [ENSMUST00000124375]
Predicted Effect probably benign
Transcript: ENSMUST00000015227
SMART Domains Protein: ENSMUSP00000015227
Gene: ENSMUSG00000015083

DomainStartEndE-ValueType
Pfam:Lipocalin 14 152 3.3e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000015239
AA Change: N233K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000015239
Gene: ENSMUSG00000015095
AA Change: N233K

DomainStartEndE-ValueType
FBOX 9 49 7.7e-6 SMART
WD40 81 120 3.11e-10 SMART
WD40 456 500 1.98e1 SMART
WD40 503 542 6.28e-6 SMART
low complexity region 553 563 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040042
SMART Domains Protein: ENSMUSP00000041855
Gene: ENSMUSG00000015083

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Lipocalin 48 186 3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124258
Predicted Effect possibly damaging
Transcript: ENSMUST00000124375
AA Change: N24K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117676
Gene: ENSMUSG00000015095
AA Change: N24K

DomainStartEndE-ValueType
SCOP:d1jjub_ 116 246 1e-11 SMART
Blast:WD40 172 216 2e-25 BLAST
Blast:WD40 219 246 7e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135456
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150580
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene contains WD-40 domains, in addition to an F-box motif, so it belongs to the Fbw class. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene, however, they were found to be nonsense-mediated mRNA decay (NMD) candidates, hence not represented. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
Ankrd39 A G 1: 36,547,155 S11P probably benign Het
Aox2 A G 1: 58,299,819 S324G probably benign Het
Atl3 T C 19: 7,532,338 V477A probably benign Het
Bcar1 T C 8: 111,720,893 T151A probably benign Het
Cdc42bpg A G 19: 6,315,266 T718A possibly damaging Het
Col9a1 C T 1: 24,244,381 R843C probably damaging Het
Dnah12 T A 14: 26,709,186 D316E possibly damaging Het
Fat2 A G 11: 55,284,301 V1862A probably damaging Het
Fcer2a A G 8: 3,688,831 F75L probably benign Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Gimd1 T C 3: 132,644,408 V144A possibly damaging Het
Glt1d1 T C 5: 127,691,112 probably null Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Kansl1l C T 1: 66,773,478 D459N probably damaging Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Muc4 T C 16: 32,755,826 probably benign Het
Myom1 T A 17: 71,092,140 V999E probably damaging Het
Nckap5 A G 1: 126,027,639 L460P probably benign Het
Olfr109 T C 17: 37,466,824 M206T probably damaging Het
Phf13 A T 4: 151,992,095 N213K probably damaging Het
Phldb3 T C 7: 24,627,320 I591T probably damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Plekhh2 A G 17: 84,586,337 E860G possibly damaging Het
Rest A G 5: 77,282,112 T793A probably benign Het
Ropn1 C T 16: 34,678,456 Q205* probably null Het
Sacs A C 14: 61,203,457 K984T probably benign Het
Samd11 G A 4: 156,250,486 R102C probably damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Shank1 C A 7: 44,319,736 H352N unknown Het
Slc22a27 A T 19: 7,925,879 I162K possibly damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Tln1 A T 4: 43,536,104 V2027E probably damaging Het
Trdn A G 10: 33,450,998 I594M probably benign Het
Trim5 C G 7: 104,276,815 E180Q possibly damaging Het
Tsen2 A G 6: 115,547,824 probably benign Het
Tubb1 A T 2: 174,455,733 E45V probably null Het
Vmn2r67 T A 7: 85,150,514 probably null Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 121,604,292 probably benign Het
Zfp160 T A 17: 21,025,738 F183L probably benign Het
Other mutations in Fbxw5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02053:Fbxw5 APN 2 25503441 missense probably damaging 0.99
IGL02162:Fbxw5 APN 2 25503271 missense probably damaging 0.96
IGL02261:Fbxw5 APN 2 25503734 missense probably benign 0.01
IGL02298:Fbxw5 APN 2 25504444 nonsense probably null
IGL02822:Fbxw5 APN 2 25503010 missense probably benign 0.06
R0416:Fbxw5 UTSW 2 25503239 missense probably damaging 1.00
R0423:Fbxw5 UTSW 2 25504526 missense possibly damaging 0.90
R0616:Fbxw5 UTSW 2 25502505 missense probably damaging 1.00
R0730:Fbxw5 UTSW 2 25504618 missense possibly damaging 0.49
R1660:Fbxw5 UTSW 2 25503274 critical splice donor site probably null
R1697:Fbxw5 UTSW 2 25502461 missense possibly damaging 0.88
R1737:Fbxw5 UTSW 2 25503584 missense probably benign 0.01
R2030:Fbxw5 UTSW 2 25504798 missense probably damaging 1.00
R2274:Fbxw5 UTSW 2 25504761 nonsense probably null
R2406:Fbxw5 UTSW 2 25504183 missense probably damaging 1.00
R3815:Fbxw5 UTSW 2 25503564 missense possibly damaging 0.62
R4082:Fbxw5 UTSW 2 25504631 critical splice donor site probably null
R6170:Fbxw5 UTSW 2 25503603 missense possibly damaging 0.96
R6502:Fbxw5 UTSW 2 25502436 missense possibly damaging 0.68
R7826:Fbxw5 UTSW 2 25502549 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAACAATGCCTTCCAGGTTCAG -3'
(R):5'- CCAGAAGTGTGCAAACCTGG -3'

Sequencing Primer
(F):5'- TTCAGACCGGGACAGGGAC -3'
(R):5'- TGTGCAAACCTGGGTCAG -3'
Posted On2015-06-12