Incidental Mutation 'R4249:Fbxw5'
ID 320518
Institutional Source Beutler Lab
Gene Symbol Fbxw5
Ensembl Gene ENSMUSG00000015095
Gene Name F-box and WD-40 domain protein 5
Synonyms Fbw5
MMRRC Submission 041065-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.416) question?
Stock # R4249 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 25390762-25395482 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 25393472 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 233 (N233K)
Ref Sequence ENSEMBL: ENSMUSP00000015239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015227] [ENSMUST00000015239] [ENSMUST00000040042] [ENSMUST00000124375]
AlphaFold Q9QXW2
Predicted Effect probably benign
Transcript: ENSMUST00000015227
SMART Domains Protein: ENSMUSP00000015227
Gene: ENSMUSG00000015083

DomainStartEndE-ValueType
Pfam:Lipocalin 14 152 3.3e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000015239
AA Change: N233K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000015239
Gene: ENSMUSG00000015095
AA Change: N233K

DomainStartEndE-ValueType
FBOX 9 49 7.7e-6 SMART
WD40 81 120 3.11e-10 SMART
WD40 456 500 1.98e1 SMART
WD40 503 542 6.28e-6 SMART
low complexity region 553 563 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040042
SMART Domains Protein: ENSMUSP00000041855
Gene: ENSMUSG00000015083

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Lipocalin 48 186 3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124258
Predicted Effect possibly damaging
Transcript: ENSMUST00000124375
AA Change: N24K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117676
Gene: ENSMUSG00000015095
AA Change: N24K

DomainStartEndE-ValueType
SCOP:d1jjub_ 116 246 1e-11 SMART
Blast:WD40 172 216 2e-25 BLAST
Blast:WD40 219 246 7e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135456
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149062
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene contains WD-40 domains, in addition to an F-box motif, so it belongs to the Fbw class. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene, however, they were found to be nonsense-mediated mRNA decay (NMD) candidates, hence not represented. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,606,013 (GRCm39) N36S possibly damaging Het
Ankrd39 A G 1: 36,586,236 (GRCm39) S11P probably benign Het
Aox1 A G 1: 58,338,978 (GRCm39) S324G probably benign Het
Atl3 T C 19: 7,509,703 (GRCm39) V477A probably benign Het
Bcar1 T C 8: 112,447,525 (GRCm39) T151A probably benign Het
Cdc42bpg A G 19: 6,365,296 (GRCm39) T718A possibly damaging Het
Col9a1 C T 1: 24,283,462 (GRCm39) R843C probably damaging Het
Dnah12 T A 14: 26,430,341 (GRCm39) D316E possibly damaging Het
Fat2 A G 11: 55,175,127 (GRCm39) V1862A probably damaging Het
Fcer2a A G 8: 3,738,831 (GRCm39) F75L probably benign Het
Fhod3 A G 18: 25,123,123 (GRCm39) K271R probably null Het
Gimd1 T C 3: 132,350,169 (GRCm39) V144A possibly damaging Het
Glt1d1 T C 5: 127,768,176 (GRCm39) probably null Het
Hecw2 C T 1: 53,871,804 (GRCm39) V1381M probably damaging Het
Kansl1l C T 1: 66,812,637 (GRCm39) D459N probably damaging Het
Lmtk3 G A 7: 45,443,486 (GRCm39) C723Y possibly damaging Het
Muc4 T C 16: 32,576,200 (GRCm39) probably benign Het
Myom1 T A 17: 71,399,135 (GRCm39) V999E probably damaging Het
Nckap5 A G 1: 125,955,376 (GRCm39) L460P probably benign Het
Or12d17 T C 17: 37,777,715 (GRCm39) M206T probably damaging Het
Phf13 A T 4: 152,076,552 (GRCm39) N213K probably damaging Het
Phldb3 T C 7: 24,326,745 (GRCm39) I591T probably damaging Het
Pik3cb T C 9: 98,983,229 (GRCm39) probably null Het
Pkd1l1 C T 11: 8,815,543 (GRCm39) R1456K possibly damaging Het
Plekhh2 A G 17: 84,893,765 (GRCm39) E860G possibly damaging Het
Resf1 T A 6: 149,227,041 (GRCm39) M29K possibly damaging Het
Rest A G 5: 77,429,959 (GRCm39) T793A probably benign Het
Ropn1 C T 16: 34,498,826 (GRCm39) Q205* probably null Het
Sacs A C 14: 61,440,906 (GRCm39) K984T probably benign Het
Samd11 G A 4: 156,334,943 (GRCm39) R102C probably damaging Het
Satl1 A G X: 111,316,033 (GRCm39) S141P probably benign Het
Shank1 C A 7: 43,969,160 (GRCm39) H352N unknown Het
Slc22a27 A T 19: 7,903,244 (GRCm39) I162K possibly damaging Het
Snx8 A G 5: 140,341,800 (GRCm39) L121P probably damaging Het
Sumf1 A C 6: 108,131,974 (GRCm39) V156G probably damaging Het
Tln1 A T 4: 43,536,104 (GRCm39) V2027E probably damaging Het
Trdn A G 10: 33,326,994 (GRCm39) I594M probably benign Het
Trim5 C G 7: 103,926,022 (GRCm39) E180Q possibly damaging Het
Tsen2 A G 6: 115,524,785 (GRCm39) probably benign Het
Tubb1 A T 2: 174,297,526 (GRCm39) E45V probably null Het
Vmn2r67 T A 7: 84,799,722 (GRCm39) probably null Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 122,331,031 (GRCm39) probably benign Het
Zfp160 T A 17: 21,246,000 (GRCm39) F183L probably benign Het
Other mutations in Fbxw5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02053:Fbxw5 APN 2 25,393,453 (GRCm39) missense probably damaging 0.99
IGL02162:Fbxw5 APN 2 25,393,283 (GRCm39) missense probably damaging 0.96
IGL02261:Fbxw5 APN 2 25,393,746 (GRCm39) missense probably benign 0.01
IGL02298:Fbxw5 APN 2 25,394,456 (GRCm39) nonsense probably null
IGL02822:Fbxw5 APN 2 25,393,022 (GRCm39) missense probably benign 0.06
R0416:Fbxw5 UTSW 2 25,393,251 (GRCm39) missense probably damaging 1.00
R0423:Fbxw5 UTSW 2 25,394,538 (GRCm39) missense possibly damaging 0.90
R0616:Fbxw5 UTSW 2 25,392,517 (GRCm39) missense probably damaging 1.00
R0730:Fbxw5 UTSW 2 25,394,630 (GRCm39) missense possibly damaging 0.49
R1660:Fbxw5 UTSW 2 25,393,286 (GRCm39) critical splice donor site probably null
R1697:Fbxw5 UTSW 2 25,392,473 (GRCm39) missense possibly damaging 0.88
R1737:Fbxw5 UTSW 2 25,393,596 (GRCm39) missense probably benign 0.01
R2030:Fbxw5 UTSW 2 25,394,810 (GRCm39) missense probably damaging 1.00
R2274:Fbxw5 UTSW 2 25,394,773 (GRCm39) nonsense probably null
R2406:Fbxw5 UTSW 2 25,394,195 (GRCm39) missense probably damaging 1.00
R3815:Fbxw5 UTSW 2 25,393,576 (GRCm39) missense possibly damaging 0.62
R4082:Fbxw5 UTSW 2 25,394,643 (GRCm39) critical splice donor site probably null
R6170:Fbxw5 UTSW 2 25,393,615 (GRCm39) missense possibly damaging 0.96
R6502:Fbxw5 UTSW 2 25,392,448 (GRCm39) missense possibly damaging 0.68
R7826:Fbxw5 UTSW 2 25,392,561 (GRCm39) nonsense probably null
R9658:Fbxw5 UTSW 2 25,393,870 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACAATGCCTTCCAGGTTCAG -3'
(R):5'- CCAGAAGTGTGCAAACCTGG -3'

Sequencing Primer
(F):5'- TTCAGACCGGGACAGGGAC -3'
(R):5'- TGTGCAAACCTGGGTCAG -3'
Posted On 2015-06-12