Incidental Mutation 'R4249:Gimd1'
ID320520
Institutional Source Beutler Lab
Gene Symbol Gimd1
Ensembl Gene ENSMUSG00000091721
Gene NameGIMAP family P-loop NTPase domain containing 1
SynonymsGm5549
MMRRC Submission 041065-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R4249 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location132629820-132645351 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132644408 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 144 (V144A)
Ref Sequence ENSEMBL: ENSMUSP00000148832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163241] [ENSMUST00000196701] [ENSMUST00000212594] [ENSMUST00000212804] [ENSMUST00000212852]
Predicted Effect possibly damaging
Transcript: ENSMUST00000163241
AA Change: V144A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126832
Gene: ENSMUSG00000091721
AA Change: V144A

DomainStartEndE-ValueType
Pfam:AIG1 9 215 5.2e-30 PFAM
Pfam:MMR_HSR1 10 210 1.5e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000196701
AA Change: V144A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142630
Gene: ENSMUSG00000091721
AA Change: V144A

DomainStartEndE-ValueType
Pfam:AIG1 9 215 6.4e-30 PFAM
Pfam:MMR_HSR1 10 210 5e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000212594
AA Change: V144A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212804
AA Change: V144A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212852
AA Change: V26A

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
Ankrd39 A G 1: 36,547,155 S11P probably benign Het
Aox2 A G 1: 58,299,819 S324G probably benign Het
Atl3 T C 19: 7,532,338 V477A probably benign Het
Bcar1 T C 8: 111,720,893 T151A probably benign Het
Cdc42bpg A G 19: 6,315,266 T718A possibly damaging Het
Col9a1 C T 1: 24,244,381 R843C probably damaging Het
Dnah12 T A 14: 26,709,186 D316E possibly damaging Het
Fat2 A G 11: 55,284,301 V1862A probably damaging Het
Fbxw5 C A 2: 25,503,460 N233K probably damaging Het
Fcer2a A G 8: 3,688,831 F75L probably benign Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Glt1d1 T C 5: 127,691,112 probably null Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Kansl1l C T 1: 66,773,478 D459N probably damaging Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Muc4 T C 16: 32,755,826 probably benign Het
Myom1 T A 17: 71,092,140 V999E probably damaging Het
Nckap5 A G 1: 126,027,639 L460P probably benign Het
Olfr109 T C 17: 37,466,824 M206T probably damaging Het
Phf13 A T 4: 151,992,095 N213K probably damaging Het
Phldb3 T C 7: 24,627,320 I591T probably damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Plekhh2 A G 17: 84,586,337 E860G possibly damaging Het
Rest A G 5: 77,282,112 T793A probably benign Het
Ropn1 C T 16: 34,678,456 Q205* probably null Het
Sacs A C 14: 61,203,457 K984T probably benign Het
Samd11 G A 4: 156,250,486 R102C probably damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Shank1 C A 7: 44,319,736 H352N unknown Het
Slc22a27 A T 19: 7,925,879 I162K possibly damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Tln1 A T 4: 43,536,104 V2027E probably damaging Het
Trdn A G 10: 33,450,998 I594M probably benign Het
Trim5 C G 7: 104,276,815 E180Q possibly damaging Het
Tsen2 A G 6: 115,547,824 probably benign Het
Tubb1 A T 2: 174,455,733 E45V probably null Het
Vmn2r67 T A 7: 85,150,514 probably null Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 121,604,292 probably benign Het
Zfp160 T A 17: 21,025,738 F183L probably benign Het
Other mutations in Gimd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0400:Gimd1 UTSW 3 132634827 missense probably benign
R4658:Gimd1 UTSW 3 132644582 missense probably damaging 1.00
R4710:Gimd1 UTSW 3 132634848 missense possibly damaging 0.95
R4992:Gimd1 UTSW 3 132634957 missense probably benign 0.39
R8758:Gimd1 UTSW 3 132635038 missense not run
Z1177:Gimd1 UTSW 3 132635070 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAGAAATATCATGACACATGGGTC -3'
(R):5'- GACCCTGATTAATACCTGGAGCTC -3'

Sequencing Primer
(F):5'- ACACATGGGTCTGTTGGCTAAC -3'
(R):5'- TGATTAATACCTGGAGCTCTCTTC -3'
Posted On2015-06-12