Incidental Mutation 'R4249:Tln1'
ID 320521
Institutional Source Beutler Lab
Gene Symbol Tln1
Ensembl Gene ENSMUSG00000028465
Gene Name talin 1
Synonyms
MMRRC Submission 041065-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4249 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 43531513-43562583 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 43536104 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 2027 (V2027E)
Ref Sequence ENSEMBL: ENSMUSP00000030187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030187]
AlphaFold P26039
PDB Structure Crystal Structure of Talin Rod 482-655 [X-RAY DIFFRACTION]
Crystal Structure of talin residues 482-789 [X-RAY DIFFRACTION]
Vinculin complexed with the VBS1 helix from talin [X-RAY DIFFRACTION]
Solution structure of VBS2 fragment of talin [SOLUTION NMR]
Structural basis for phosphatidylinositol phosphate kinase type I-gamma binding to talin at focal adhesions [X-RAY DIFFRACTION]
Vinculin Head (0-258) in Complex with the Talin Rod residues 1630-1652 [X-RAY DIFFRACTION]
Solution structure of VBS3 fragment of talin [SOLUTION NMR]
NMR structure of talin-PTB in complex with PIPKI [SOLUTION NMR]
NMR structure of the talin C-terminal actin binding site [SOLUTION NMR]
NMR structure of the talin rod domain, 1655-1822 [SOLUTION NMR]
>> 16 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000030187
AA Change: V2027E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465
AA Change: V2027E

DomainStartEndE-ValueType
Blast:B41 2 76 5e-31 BLAST
B41 82 313 4.66e-73 SMART
IRS 308 401 7.65e-16 SMART
Pfam:Talin_middle 491 652 8.2e-60 PFAM
low complexity region 671 690 N/A INTRINSIC
internal_repeat_2 699 760 8.94e-6 PROSPERO
low complexity region 766 775 N/A INTRINSIC
PDB:1ZVZ|B 820 844 2e-7 PDB
low complexity region 866 879 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
PDB:2LQG|A 913 1044 2e-44 PDB
PDB:2L7N|A 1046 1207 1e-101 PDB
Pfam:VBS 1234 1358 9.6e-8 PFAM
internal_repeat_2 1488 1549 8.94e-6 PROSPERO
internal_repeat_3 1623 1769 4.92e-5 PROSPERO
low complexity region 1817 1828 N/A INTRINSIC
Pfam:VBS 1849 1973 6.2e-67 PFAM
PDB:3DYJ|B 1974 2293 N/A PDB
low complexity region 2305 2327 N/A INTRINSIC
ILWEQ 2336 2533 2.93e-105 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,606,013 (GRCm39) N36S possibly damaging Het
Ankrd39 A G 1: 36,586,236 (GRCm39) S11P probably benign Het
Aox1 A G 1: 58,338,978 (GRCm39) S324G probably benign Het
Atl3 T C 19: 7,509,703 (GRCm39) V477A probably benign Het
Bcar1 T C 8: 112,447,525 (GRCm39) T151A probably benign Het
Cdc42bpg A G 19: 6,365,296 (GRCm39) T718A possibly damaging Het
Col9a1 C T 1: 24,283,462 (GRCm39) R843C probably damaging Het
Dnah12 T A 14: 26,430,341 (GRCm39) D316E possibly damaging Het
Fat2 A G 11: 55,175,127 (GRCm39) V1862A probably damaging Het
Fbxw5 C A 2: 25,393,472 (GRCm39) N233K probably damaging Het
Fcer2a A G 8: 3,738,831 (GRCm39) F75L probably benign Het
Fhod3 A G 18: 25,123,123 (GRCm39) K271R probably null Het
Gimd1 T C 3: 132,350,169 (GRCm39) V144A possibly damaging Het
Glt1d1 T C 5: 127,768,176 (GRCm39) probably null Het
Hecw2 C T 1: 53,871,804 (GRCm39) V1381M probably damaging Het
Kansl1l C T 1: 66,812,637 (GRCm39) D459N probably damaging Het
Lmtk3 G A 7: 45,443,486 (GRCm39) C723Y possibly damaging Het
Muc4 T C 16: 32,576,200 (GRCm39) probably benign Het
Myom1 T A 17: 71,399,135 (GRCm39) V999E probably damaging Het
Nckap5 A G 1: 125,955,376 (GRCm39) L460P probably benign Het
Or12d17 T C 17: 37,777,715 (GRCm39) M206T probably damaging Het
Phf13 A T 4: 152,076,552 (GRCm39) N213K probably damaging Het
Phldb3 T C 7: 24,326,745 (GRCm39) I591T probably damaging Het
Pik3cb T C 9: 98,983,229 (GRCm39) probably null Het
Pkd1l1 C T 11: 8,815,543 (GRCm39) R1456K possibly damaging Het
Plekhh2 A G 17: 84,893,765 (GRCm39) E860G possibly damaging Het
Resf1 T A 6: 149,227,041 (GRCm39) M29K possibly damaging Het
Rest A G 5: 77,429,959 (GRCm39) T793A probably benign Het
Ropn1 C T 16: 34,498,826 (GRCm39) Q205* probably null Het
Sacs A C 14: 61,440,906 (GRCm39) K984T probably benign Het
Samd11 G A 4: 156,334,943 (GRCm39) R102C probably damaging Het
Satl1 A G X: 111,316,033 (GRCm39) S141P probably benign Het
Shank1 C A 7: 43,969,160 (GRCm39) H352N unknown Het
Slc22a27 A T 19: 7,903,244 (GRCm39) I162K possibly damaging Het
Snx8 A G 5: 140,341,800 (GRCm39) L121P probably damaging Het
Sumf1 A C 6: 108,131,974 (GRCm39) V156G probably damaging Het
Trdn A G 10: 33,326,994 (GRCm39) I594M probably benign Het
Trim5 C G 7: 103,926,022 (GRCm39) E180Q possibly damaging Het
Tsen2 A G 6: 115,524,785 (GRCm39) probably benign Het
Tubb1 A T 2: 174,297,526 (GRCm39) E45V probably null Het
Vmn2r67 T A 7: 84,799,722 (GRCm39) probably null Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 122,331,031 (GRCm39) probably benign Het
Zfp160 T A 17: 21,246,000 (GRCm39) F183L probably benign Het
Other mutations in Tln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Tln1 APN 4 43,542,719 (GRCm39) missense probably benign 0.22
IGL00987:Tln1 APN 4 43,551,297 (GRCm39) unclassified probably benign
IGL01345:Tln1 APN 4 43,536,281 (GRCm39) missense probably damaging 1.00
IGL01456:Tln1 APN 4 43,543,432 (GRCm39) unclassified probably benign
IGL01715:Tln1 APN 4 43,555,890 (GRCm39) missense probably damaging 1.00
IGL01750:Tln1 APN 4 43,545,435 (GRCm39) missense probably damaging 1.00
IGL01933:Tln1 APN 4 43,555,894 (GRCm39) missense possibly damaging 0.52
IGL01933:Tln1 APN 4 43,539,508 (GRCm39) missense probably benign
IGL02119:Tln1 APN 4 43,546,760 (GRCm39) missense probably damaging 0.99
IGL02148:Tln1 APN 4 43,555,388 (GRCm39) missense probably damaging 1.00
IGL02153:Tln1 APN 4 43,546,857 (GRCm39) missense possibly damaging 0.76
IGL02522:Tln1 APN 4 43,540,612 (GRCm39) missense probably benign 0.07
IGL02691:Tln1 APN 4 43,539,544 (GRCm39) missense probably benign 0.42
IGL02882:Tln1 APN 4 43,539,522 (GRCm39) missense probably benign 0.45
IGL02892:Tln1 APN 4 43,555,679 (GRCm39) missense probably damaging 1.00
IGL03061:Tln1 APN 4 43,545,694 (GRCm39) missense probably damaging 1.00
IGL03102:Tln1 APN 4 43,532,861 (GRCm39) missense possibly damaging 0.89
IGL03183:Tln1 APN 4 43,539,084 (GRCm39) splice site probably benign
H8786:Tln1 UTSW 4 43,544,589 (GRCm39) missense probably damaging 0.97
PIT4576001:Tln1 UTSW 4 43,539,998 (GRCm39) missense probably damaging 1.00
PIT4696001:Tln1 UTSW 4 43,542,701 (GRCm39) critical splice donor site probably null
R0206:Tln1 UTSW 4 43,549,151 (GRCm39) missense probably damaging 1.00
R0208:Tln1 UTSW 4 43,549,151 (GRCm39) missense probably damaging 1.00
R0454:Tln1 UTSW 4 43,553,504 (GRCm39) missense probably benign
R0539:Tln1 UTSW 4 43,543,434 (GRCm39) critical splice donor site probably null
R0548:Tln1 UTSW 4 43,542,709 (GRCm39) missense possibly damaging 0.79
R0561:Tln1 UTSW 4 43,550,304 (GRCm39) missense possibly damaging 0.94
R0606:Tln1 UTSW 4 43,547,756 (GRCm39) missense probably benign 0.34
R0607:Tln1 UTSW 4 43,553,071 (GRCm39) missense probably damaging 1.00
R0609:Tln1 UTSW 4 43,544,645 (GRCm39) missense possibly damaging 0.63
R0847:Tln1 UTSW 4 43,555,333 (GRCm39) missense probably damaging 1.00
R0993:Tln1 UTSW 4 43,549,825 (GRCm39) missense probably benign 0.22
R1255:Tln1 UTSW 4 43,538,044 (GRCm39) missense probably damaging 1.00
R1292:Tln1 UTSW 4 43,534,578 (GRCm39) critical splice donor site probably null
R1752:Tln1 UTSW 4 43,536,311 (GRCm39) missense probably damaging 1.00
R2169:Tln1 UTSW 4 43,548,005 (GRCm39) missense probably damaging 1.00
R2172:Tln1 UTSW 4 43,545,721 (GRCm39) missense probably benign
R2202:Tln1 UTSW 4 43,553,083 (GRCm39) splice site probably null
R2680:Tln1 UTSW 4 43,539,668 (GRCm39) missense probably damaging 1.00
R3012:Tln1 UTSW 4 43,542,525 (GRCm39) missense probably benign
R3714:Tln1 UTSW 4 43,540,597 (GRCm39) missense probably damaging 1.00
R3735:Tln1 UTSW 4 43,549,370 (GRCm39) missense probably damaging 0.97
R3794:Tln1 UTSW 4 43,536,295 (GRCm39) missense probably damaging 1.00
R3825:Tln1 UTSW 4 43,536,413 (GRCm39) splice site probably benign
R3983:Tln1 UTSW 4 43,553,030 (GRCm39) missense probably damaging 1.00
R4061:Tln1 UTSW 4 43,549,177 (GRCm39) missense probably damaging 1.00
R4287:Tln1 UTSW 4 43,543,509 (GRCm39) missense probably benign 0.01
R4471:Tln1 UTSW 4 43,551,018 (GRCm39) missense probably benign 0.03
R4562:Tln1 UTSW 4 43,533,598 (GRCm39) missense probably damaging 1.00
R4654:Tln1 UTSW 4 43,535,954 (GRCm39) missense probably null 1.00
R4737:Tln1 UTSW 4 43,540,588 (GRCm39) missense probably benign 0.00
R4936:Tln1 UTSW 4 43,547,522 (GRCm39) missense possibly damaging 0.83
R5225:Tln1 UTSW 4 43,539,406 (GRCm39) missense probably benign 0.06
R5288:Tln1 UTSW 4 43,540,661 (GRCm39) missense probably benign 0.06
R5421:Tln1 UTSW 4 43,533,609 (GRCm39) missense possibly damaging 0.80
R5445:Tln1 UTSW 4 43,543,905 (GRCm39) missense probably benign 0.26
R5660:Tln1 UTSW 4 43,547,732 (GRCm39) missense probably damaging 1.00
R5772:Tln1 UTSW 4 43,545,191 (GRCm39) missense probably benign 0.13
R6012:Tln1 UTSW 4 43,539,508 (GRCm39) missense probably benign
R6038:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6038:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6039:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6039:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6052:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6145:Tln1 UTSW 4 43,538,030 (GRCm39) missense possibly damaging 0.64
R6157:Tln1 UTSW 4 43,534,744 (GRCm39) missense probably benign 0.06
R6242:Tln1 UTSW 4 43,533,145 (GRCm39) missense probably damaging 1.00
R6454:Tln1 UTSW 4 43,533,866 (GRCm39) missense probably damaging 0.99
R6467:Tln1 UTSW 4 43,543,165 (GRCm39) missense probably benign 0.42
R6548:Tln1 UTSW 4 43,547,525 (GRCm39) missense probably damaging 0.98
R6576:Tln1 UTSW 4 43,555,419 (GRCm39) splice site probably null
R6722:Tln1 UTSW 4 43,547,618 (GRCm39) missense probably damaging 1.00
R6968:Tln1 UTSW 4 43,550,217 (GRCm39) missense probably benign 0.02
R7000:Tln1 UTSW 4 43,556,302 (GRCm39) missense probably damaging 0.96
R7137:Tln1 UTSW 4 43,540,616 (GRCm39) missense probably damaging 1.00
R7242:Tln1 UTSW 4 43,542,602 (GRCm39) missense probably benign 0.01
R7294:Tln1 UTSW 4 43,534,399 (GRCm39) missense probably benign 0.02
R7312:Tln1 UTSW 4 43,545,922 (GRCm39) missense probably damaging 1.00
R7547:Tln1 UTSW 4 43,545,206 (GRCm39) missense possibly damaging 0.80
R7836:Tln1 UTSW 4 43,554,309 (GRCm39) missense probably benign 0.01
R7874:Tln1 UTSW 4 43,555,606 (GRCm39) missense probably damaging 1.00
R7874:Tln1 UTSW 4 43,538,041 (GRCm39) missense probably damaging 1.00
R8030:Tln1 UTSW 4 43,535,737 (GRCm39) critical splice donor site probably null
R8105:Tln1 UTSW 4 43,538,231 (GRCm39) missense probably benign 0.32
R8212:Tln1 UTSW 4 43,555,918 (GRCm39) missense probably damaging 1.00
R8416:Tln1 UTSW 4 43,540,116 (GRCm39) missense probably benign 0.01
R8419:Tln1 UTSW 4 43,536,397 (GRCm39) missense probably damaging 1.00
R8680:Tln1 UTSW 4 43,553,041 (GRCm39) missense possibly damaging 0.52
R8708:Tln1 UTSW 4 43,534,769 (GRCm39) splice site probably benign
R8725:Tln1 UTSW 4 43,555,911 (GRCm39) missense possibly damaging 0.94
R8727:Tln1 UTSW 4 43,555,911 (GRCm39) missense possibly damaging 0.94
R8830:Tln1 UTSW 4 43,556,383 (GRCm39) missense probably benign
R8865:Tln1 UTSW 4 43,538,281 (GRCm39) missense possibly damaging 0.93
R9049:Tln1 UTSW 4 43,549,786 (GRCm39) nonsense probably null
R9050:Tln1 UTSW 4 43,549,786 (GRCm39) nonsense probably null
R9145:Tln1 UTSW 4 43,536,024 (GRCm39) missense probably damaging 1.00
R9210:Tln1 UTSW 4 43,536,119 (GRCm39) missense probably damaging 1.00
R9337:Tln1 UTSW 4 43,532,927 (GRCm39) missense probably damaging 1.00
R9346:Tln1 UTSW 4 43,546,895 (GRCm39) missense probably damaging 0.97
R9358:Tln1 UTSW 4 43,532,084 (GRCm39) missense possibly damaging 0.68
R9487:Tln1 UTSW 4 43,542,893 (GRCm39) missense probably damaging 1.00
R9631:Tln1 UTSW 4 43,545,694 (GRCm39) missense probably damaging 1.00
R9650:Tln1 UTSW 4 43,545,912 (GRCm39) missense probably damaging 1.00
R9666:Tln1 UTSW 4 43,542,957 (GRCm39) missense probably damaging 0.96
RF021:Tln1 UTSW 4 43,555,890 (GRCm39) missense probably damaging 1.00
X0052:Tln1 UTSW 4 43,533,125 (GRCm39) critical splice donor site probably null
X0063:Tln1 UTSW 4 43,548,015 (GRCm39) nonsense probably null
Z1176:Tln1 UTSW 4 43,543,211 (GRCm39) missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GTGTGGGAGACATTACTCTGC -3'
(R):5'- CTGGCACACTTAACCGTGAG -3'

Sequencing Primer
(F):5'- AGACATTACTCTGCTTTGTGAGG -3'
(R):5'- AGGGTGCTGAAACTTTTGCTGAC -3'
Posted On 2015-06-12