Incidental Mutation 'R4249:Phf13'
ID320522
Institutional Source Beutler Lab
Gene Symbol Phf13
Ensembl Gene ENSMUSG00000047777
Gene NamePHD finger protein 13
Synonyms
MMRRC Submission 041065-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R4249 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location151989633-151996258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 151992095 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 213 (N213K)
Ref Sequence ENSEMBL: ENSMUSP00000062590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036680] [ENSMUST00000055688] [ENSMUST00000105665]
Predicted Effect probably benign
Transcript: ENSMUST00000036680
SMART Domains Protein: ENSMUSP00000035240
Gene: ENSMUSG00000039759

DomainStartEndE-ValueType
THAP 3 88 5.28e-19 SMART
DM3 23 87 6.96e-21 SMART
coiled coil region 166 189 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000055688
AA Change: N213K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000062590
Gene: ENSMUSG00000047777
AA Change: N213K

DomainStartEndE-ValueType
low complexity region 103 122 N/A INTRINSIC
low complexity region 214 227 N/A INTRINSIC
PHD 230 274 4.35e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105665
SMART Domains Protein: ENSMUSP00000101290
Gene: ENSMUSG00000039759

DomainStartEndE-ValueType
THAP 3 88 5.28e-19 SMART
DM3 23 87 6.96e-21 SMART
coiled coil region 132 155 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146471
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit reduced male fertility over time associated with impaired spermatogonial stem cell differentiation and male germ cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
Ankrd39 A G 1: 36,547,155 S11P probably benign Het
Aox2 A G 1: 58,299,819 S324G probably benign Het
Atl3 T C 19: 7,532,338 V477A probably benign Het
Bcar1 T C 8: 111,720,893 T151A probably benign Het
Cdc42bpg A G 19: 6,315,266 T718A possibly damaging Het
Col9a1 C T 1: 24,244,381 R843C probably damaging Het
Dnah12 T A 14: 26,709,186 D316E possibly damaging Het
Fat2 A G 11: 55,284,301 V1862A probably damaging Het
Fbxw5 C A 2: 25,503,460 N233K probably damaging Het
Fcer2a A G 8: 3,688,831 F75L probably benign Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Gimd1 T C 3: 132,644,408 V144A possibly damaging Het
Glt1d1 T C 5: 127,691,112 probably null Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Kansl1l C T 1: 66,773,478 D459N probably damaging Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Muc4 T C 16: 32,755,826 probably benign Het
Myom1 T A 17: 71,092,140 V999E probably damaging Het
Nckap5 A G 1: 126,027,639 L460P probably benign Het
Olfr109 T C 17: 37,466,824 M206T probably damaging Het
Phldb3 T C 7: 24,627,320 I591T probably damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Plekhh2 A G 17: 84,586,337 E860G possibly damaging Het
Rest A G 5: 77,282,112 T793A probably benign Het
Ropn1 C T 16: 34,678,456 Q205* probably null Het
Sacs A C 14: 61,203,457 K984T probably benign Het
Samd11 G A 4: 156,250,486 R102C probably damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Shank1 C A 7: 44,319,736 H352N unknown Het
Slc22a27 A T 19: 7,925,879 I162K possibly damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Tln1 A T 4: 43,536,104 V2027E probably damaging Het
Trdn A G 10: 33,450,998 I594M probably benign Het
Trim5 C G 7: 104,276,815 E180Q possibly damaging Het
Tsen2 A G 6: 115,547,824 probably benign Het
Tubb1 A T 2: 174,455,733 E45V probably null Het
Vmn2r67 T A 7: 85,150,514 probably null Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 121,604,292 probably benign Het
Zfp160 T A 17: 21,025,738 F183L probably benign Het
Other mutations in Phf13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Phf13 APN 4 151995828 missense probably benign
IGL03288:Phf13 APN 4 151992369 missense possibly damaging 0.74
R0685:Phf13 UTSW 4 151991612 missense probably damaging 0.96
R1660:Phf13 UTSW 4 151992505 missense probably benign
R3052:Phf13 UTSW 4 151992363 missense possibly damaging 0.53
R5232:Phf13 UTSW 4 151992223 missense probably damaging 0.99
R6619:Phf13 UTSW 4 151991657 missense probably damaging 1.00
R6801:Phf13 UTSW 4 151991560 missense probably damaging 1.00
R7590:Phf13 UTSW 4 151991775 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCCAGCTATCACTCATGG -3'
(R):5'- CACCATGCAGGATATTCCCC -3'

Sequencing Primer
(F):5'- AGCTATCACTCATGGGCCAG -3'
(R):5'- AGGATATTCCCCAGGCGTCTG -3'
Posted On2015-06-12