Incidental Mutation 'R4249:Samd11'
ID320523
Institutional Source Beutler Lab
Gene Symbol Samd11
Ensembl Gene ENSMUSG00000096351
Gene Namesterile alpha motif domain containing 11
Synonymsmr-s
MMRRC Submission 041065-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R4249 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location156246966-156255657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 156250486 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 102 (R102C)
Ref Sequence ENSEMBL: ENSMUSP00000151817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179543] [ENSMUST00000179886] [ENSMUST00000179919] [ENSMUST00000217934] [ENSMUST00000218788] [ENSMUST00000219393] [ENSMUST00000220228]
Predicted Effect probably benign
Transcript: ENSMUST00000179543
SMART Domains Protein: ENSMUSP00000137253
Gene: ENSMUSG00000095567

DomainStartEndE-ValueType
low complexity region 21 58 N/A INTRINSIC
low complexity region 97 114 N/A INTRINSIC
low complexity region 121 139 N/A INTRINSIC
Pfam:Noc2 331 626 1.8e-128 PFAM
low complexity region 651 675 N/A INTRINSIC
low complexity region 701 723 N/A INTRINSIC
low complexity region 738 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179886
SMART Domains Protein: ENSMUSP00000137183
Gene: ENSMUSG00000095567

DomainStartEndE-ValueType
Pfam:Noc2 172 470 1.2e-117 PFAM
low complexity region 494 518 N/A INTRINSIC
low complexity region 544 566 N/A INTRINSIC
low complexity region 581 593 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179919
AA Change: R112C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136611
Gene: ENSMUSG00000096351
AA Change: R112C

DomainStartEndE-ValueType
low complexity region 277 295 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
low complexity region 401 410 N/A INTRINSIC
SAM 411 478 1.82e-6 SMART
low complexity region 486 503 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217800
Predicted Effect probably damaging
Transcript: ENSMUST00000217934
AA Change: R102C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218230
Predicted Effect probably damaging
Transcript: ENSMUST00000218788
AA Change: R102C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219310
Predicted Effect probably damaging
Transcript: ENSMUST00000219393
AA Change: R102C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219866
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220030
Predicted Effect probably benign
Transcript: ENSMUST00000220228
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
Ankrd39 A G 1: 36,547,155 S11P probably benign Het
Aox2 A G 1: 58,299,819 S324G probably benign Het
Atl3 T C 19: 7,532,338 V477A probably benign Het
Bcar1 T C 8: 111,720,893 T151A probably benign Het
Cdc42bpg A G 19: 6,315,266 T718A possibly damaging Het
Col9a1 C T 1: 24,244,381 R843C probably damaging Het
Dnah12 T A 14: 26,709,186 D316E possibly damaging Het
Fat2 A G 11: 55,284,301 V1862A probably damaging Het
Fbxw5 C A 2: 25,503,460 N233K probably damaging Het
Fcer2a A G 8: 3,688,831 F75L probably benign Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Gimd1 T C 3: 132,644,408 V144A possibly damaging Het
Glt1d1 T C 5: 127,691,112 probably null Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Kansl1l C T 1: 66,773,478 D459N probably damaging Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Muc4 T C 16: 32,755,826 probably benign Het
Myom1 T A 17: 71,092,140 V999E probably damaging Het
Nckap5 A G 1: 126,027,639 L460P probably benign Het
Olfr109 T C 17: 37,466,824 M206T probably damaging Het
Phf13 A T 4: 151,992,095 N213K probably damaging Het
Phldb3 T C 7: 24,627,320 I591T probably damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Plekhh2 A G 17: 84,586,337 E860G possibly damaging Het
Rest A G 5: 77,282,112 T793A probably benign Het
Ropn1 C T 16: 34,678,456 Q205* probably null Het
Sacs A C 14: 61,203,457 K984T probably benign Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Shank1 C A 7: 44,319,736 H352N unknown Het
Slc22a27 A T 19: 7,925,879 I162K possibly damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Tln1 A T 4: 43,536,104 V2027E probably damaging Het
Trdn A G 10: 33,450,998 I594M probably benign Het
Trim5 C G 7: 104,276,815 E180Q possibly damaging Het
Tsen2 A G 6: 115,547,824 probably benign Het
Tubb1 A T 2: 174,455,733 E45V probably null Het
Vmn2r67 T A 7: 85,150,514 probably null Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 121,604,292 probably benign Het
Zfp160 T A 17: 21,025,738 F183L probably benign Het
Other mutations in Samd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1921:Samd11 UTSW 4 156248709 missense probably damaging 1.00
R3710:Samd11 UTSW 4 156250495 missense probably damaging 1.00
R4169:Samd11 UTSW 4 156247746 missense probably damaging 1.00
R4586:Samd11 UTSW 4 156249432 missense probably damaging 1.00
R4735:Samd11 UTSW 4 156248773 missense probably benign
R4794:Samd11 UTSW 4 156249465 missense probably damaging 0.98
R6481:Samd11 UTSW 4 156249078 splice site probably null
R6583:Samd11 UTSW 4 156248134 missense possibly damaging 0.93
R7165:Samd11 UTSW 4 156252290 missense probably benign
R7357:Samd11 UTSW 4 156255007 splice site probably null
R7402:Samd11 UTSW 4 156248773 missense probably benign
R7426:Samd11 UTSW 4 156249400 missense probably benign
R7645:Samd11 UTSW 4 156255183 start gained probably benign
R7761:Samd11 UTSW 4 156247825 missense probably benign
R8413:Samd11 UTSW 4 156249273 missense probably damaging 1.00
R8716:Samd11 UTSW 4 156249270 missense not run
R8814:Samd11 UTSW 4 156247884 missense not run
R8822:Samd11 UTSW 4 156252307 missense not run
Predicted Primers PCR Primer
(F):5'- GCCTTCTCAAGTAACAAGCATAGC -3'
(R):5'- AAGCAAAGTGCCTTCCCTGC -3'

Sequencing Primer
(F):5'- TCTCAAGTAACAAGCATAGCATGTGG -3'
(R):5'- GCTGATCCTCTAGCCTGTGACAC -3'
Posted On2015-06-12