Incidental Mutation 'R4249:Glt1d1'
Institutional Source Beutler Lab
Gene Symbol Glt1d1
Ensembl Gene ENSMUSG00000049971
Gene Nameglycosyltransferase 1 domain containing 1
MMRRC Submission 041065-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R4249 (G1)
Quality Score225
Status Not validated
Chromosomal Location127632262-127709374 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 127691112 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118139]
Predicted Effect probably null
Transcript: ENSMUST00000118139
SMART Domains Protein: ENSMUSP00000113864
Gene: ENSMUSG00000049971

Pfam:Glycos_transf_1 153 319 8.2e-23 PFAM
Pfam:Glyco_trans_1_4 166 305 8.7e-15 PFAM
Pfam:Glyco_trans_1_2 244 335 8.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137157
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
Ankrd39 A G 1: 36,547,155 S11P probably benign Het
Aox2 A G 1: 58,299,819 S324G probably benign Het
Atl3 T C 19: 7,532,338 V477A probably benign Het
Bcar1 T C 8: 111,720,893 T151A probably benign Het
Cdc42bpg A G 19: 6,315,266 T718A possibly damaging Het
Col9a1 C T 1: 24,244,381 R843C probably damaging Het
Dnah12 T A 14: 26,709,186 D316E possibly damaging Het
Fat2 A G 11: 55,284,301 V1862A probably damaging Het
Fbxw5 C A 2: 25,503,460 N233K probably damaging Het
Fcer2a A G 8: 3,688,831 F75L probably benign Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Gimd1 T C 3: 132,644,408 V144A possibly damaging Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Kansl1l C T 1: 66,773,478 D459N probably damaging Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Muc4 T C 16: 32,755,826 probably benign Het
Myom1 T A 17: 71,092,140 V999E probably damaging Het
Nckap5 A G 1: 126,027,639 L460P probably benign Het
Olfr109 T C 17: 37,466,824 M206T probably damaging Het
Phf13 A T 4: 151,992,095 N213K probably damaging Het
Phldb3 T C 7: 24,627,320 I591T probably damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Plekhh2 A G 17: 84,586,337 E860G possibly damaging Het
Rest A G 5: 77,282,112 T793A probably benign Het
Ropn1 C T 16: 34,678,456 Q205* probably null Het
Sacs A C 14: 61,203,457 K984T probably benign Het
Samd11 G A 4: 156,250,486 R102C probably damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Shank1 C A 7: 44,319,736 H352N unknown Het
Slc22a27 A T 19: 7,925,879 I162K possibly damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Tln1 A T 4: 43,536,104 V2027E probably damaging Het
Trdn A G 10: 33,450,998 I594M probably benign Het
Trim5 C G 7: 104,276,815 E180Q possibly damaging Het
Tsen2 A G 6: 115,547,824 probably benign Het
Tubb1 A T 2: 174,455,733 E45V probably null Het
Vmn2r67 T A 7: 85,150,514 probably null Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 121,604,292 probably benign Het
Zfp160 T A 17: 21,025,738 F183L probably benign Het
Other mutations in Glt1d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Glt1d1 APN 5 127632285 start codon destroyed probably null 1.00
IGL01310:Glt1d1 APN 5 127632320 missense possibly damaging 0.86
IGL01608:Glt1d1 APN 5 127664682 missense possibly damaging 0.56
IGL01738:Glt1d1 APN 5 127632355 intron probably benign
IGL02028:Glt1d1 APN 5 127706920 missense possibly damaging 0.63
IGL02273:Glt1d1 APN 5 127657144 splice site probably benign
IGL02603:Glt1d1 APN 5 127632345 missense probably damaging 1.00
IGL02718:Glt1d1 APN 5 127650699 missense probably damaging 0.98
IGL02850:Glt1d1 APN 5 127644345 missense probably benign 0.00
IGL03328:Glt1d1 APN 5 127657119 missense probably benign
R0049:Glt1d1 UTSW 5 127663327 splice site probably benign
R0312:Glt1d1 UTSW 5 127691070 missense probably damaging 1.00
R0400:Glt1d1 UTSW 5 127657075 splice site probably benign
R1838:Glt1d1 UTSW 5 127678129 missense probably benign 0.01
R2060:Glt1d1 UTSW 5 127657119 missense probably benign
R2262:Glt1d1 UTSW 5 127657112 missense probably benign 0.08
R3776:Glt1d1 UTSW 5 127694311 missense probably damaging 1.00
R4205:Glt1d1 UTSW 5 127689871 missense probably benign 0.32
R4379:Glt1d1 UTSW 5 127694282 missense possibly damaging 0.73
R5044:Glt1d1 UTSW 5 127644414 missense probably benign 0.38
R5289:Glt1d1 UTSW 5 127644356 missense probably benign 0.11
R5374:Glt1d1 UTSW 5 127657084 splice site probably null
R5533:Glt1d1 UTSW 5 127691031 missense probably damaging 1.00
R5592:Glt1d1 UTSW 5 127657119 missense probably benign 0.01
R5870:Glt1d1 UTSW 5 127677280 missense probably damaging 1.00
R5942:Glt1d1 UTSW 5 127644470 splice site probably null
R6128:Glt1d1 UTSW 5 127677271 missense probably damaging 1.00
R6349:Glt1d1 UTSW 5 127706886 missense probably benign 0.10
R6490:Glt1d1 UTSW 5 127644296 splice site probably null
R6502:Glt1d1 UTSW 5 127706981 missense probably damaging 1.00
R8205:Glt1d1 UTSW 5 127691016 missense probably benign 0.05
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-06-12