Incidental Mutation 'R4249:Snx8'
ID320527
Institutional Source Beutler Lab
Gene Symbol Snx8
Ensembl Gene ENSMUSG00000029560
Gene Namesorting nexin 8
SynonymsB130023O14Rik
MMRRC Submission 041065-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4249 (G1)
Quality Score202
Status Not validated
Chromosome5
Chromosomal Location140340299-140389262 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140356045 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 121 (L121P)
Ref Sequence ENSEMBL: ENSMUSP00000142866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031539] [ENSMUST00000196020] [ENSMUST00000196130] [ENSMUST00000196566] [ENSMUST00000197880] [ENSMUST00000198945]
Predicted Effect probably damaging
Transcript: ENSMUST00000031539
AA Change: L147P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031539
Gene: ENSMUSG00000029560
AA Change: L147P

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
PX 60 173 1.56e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195982
Predicted Effect probably damaging
Transcript: ENSMUST00000196020
AA Change: L25P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142491
Gene: ENSMUSG00000029560
AA Change: L25P

DomainStartEndE-ValueType
Pfam:PX 1 51 3.7e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196130
AA Change: L99P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142390
Gene: ENSMUSG00000029560
AA Change: L99P

DomainStartEndE-ValueType
PX 12 125 9.7e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000196566
AA Change: L99P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142556
Gene: ENSMUSG00000029560
AA Change: L99P

DomainStartEndE-ValueType
PX 12 125 9.7e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197880
SMART Domains Protein: ENSMUSP00000142394
Gene: ENSMUSG00000029560

DomainStartEndE-ValueType
Pfam:PX 15 88 1.1e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000198945
AA Change: L121P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142866
Gene: ENSMUSG00000029560
AA Change: L121P

DomainStartEndE-ValueType
PX 34 147 9.7e-21 SMART
Meta Mutation Damage Score 0.9745 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
Ankrd39 A G 1: 36,547,155 S11P probably benign Het
Aox2 A G 1: 58,299,819 S324G probably benign Het
Atl3 T C 19: 7,532,338 V477A probably benign Het
Bcar1 T C 8: 111,720,893 T151A probably benign Het
Cdc42bpg A G 19: 6,315,266 T718A possibly damaging Het
Col9a1 C T 1: 24,244,381 R843C probably damaging Het
Dnah12 T A 14: 26,709,186 D316E possibly damaging Het
Fat2 A G 11: 55,284,301 V1862A probably damaging Het
Fbxw5 C A 2: 25,503,460 N233K probably damaging Het
Fcer2a A G 8: 3,688,831 F75L probably benign Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Gimd1 T C 3: 132,644,408 V144A possibly damaging Het
Glt1d1 T C 5: 127,691,112 probably null Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Kansl1l C T 1: 66,773,478 D459N probably damaging Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Muc4 T C 16: 32,755,826 probably benign Het
Myom1 T A 17: 71,092,140 V999E probably damaging Het
Nckap5 A G 1: 126,027,639 L460P probably benign Het
Olfr109 T C 17: 37,466,824 M206T probably damaging Het
Phf13 A T 4: 151,992,095 N213K probably damaging Het
Phldb3 T C 7: 24,627,320 I591T probably damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Plekhh2 A G 17: 84,586,337 E860G possibly damaging Het
Rest A G 5: 77,282,112 T793A probably benign Het
Ropn1 C T 16: 34,678,456 Q205* probably null Het
Sacs A C 14: 61,203,457 K984T probably benign Het
Samd11 G A 4: 156,250,486 R102C probably damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Shank1 C A 7: 44,319,736 H352N unknown Het
Slc22a27 A T 19: 7,925,879 I162K possibly damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Tln1 A T 4: 43,536,104 V2027E probably damaging Het
Trdn A G 10: 33,450,998 I594M probably benign Het
Trim5 C G 7: 104,276,815 E180Q possibly damaging Het
Tsen2 A G 6: 115,547,824 probably benign Het
Tubb1 A T 2: 174,455,733 E45V probably null Het
Vmn2r67 T A 7: 85,150,514 probably null Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 121,604,292 probably benign Het
Zfp160 T A 17: 21,025,738 F183L probably benign Het
Other mutations in Snx8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Snx8 APN 5 140358096 missense probably damaging 1.00
IGL01394:Snx8 APN 5 140352179 missense probably benign 0.00
Dickens UTSW 5 140358150 missense probably damaging 1.00
R4247:Snx8 UTSW 5 140356045 missense probably damaging 1.00
R4248:Snx8 UTSW 5 140356045 missense probably damaging 1.00
R4250:Snx8 UTSW 5 140356045 missense probably damaging 1.00
R4670:Snx8 UTSW 5 140355958 critical splice donor site probably null
R4982:Snx8 UTSW 5 140352234 missense probably benign 0.06
R5339:Snx8 UTSW 5 140358150 missense probably damaging 1.00
R5341:Snx8 UTSW 5 140358131 missense probably damaging 1.00
R5755:Snx8 UTSW 5 140353041 missense possibly damaging 0.48
R5945:Snx8 UTSW 5 140353480 missense probably benign
R7214:Snx8 UTSW 5 140360253 missense possibly damaging 0.83
R7527:Snx8 UTSW 5 140356072 missense probably benign 0.32
R7851:Snx8 UTSW 5 140358159 missense probably damaging 1.00
R7960:Snx8 UTSW 5 140358093 missense probably benign 0.00
R8444:Snx8 UTSW 5 140358174 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- ATGATGCCCAGCCTGTGAAC -3'
(R):5'- CTGATAGACCTGGCCATTCCTC -3'

Sequencing Primer
(F):5'- CTCTAGTATGAGCTCAAACTGGG -3'
(R):5'- TCCACCCATGCATGTTTGG -3'
Posted On2015-06-12