Incidental Mutation 'R4249:Phldb3'
Institutional Source Beutler Lab
Gene Symbol Phldb3
Ensembl Gene ENSMUSG00000074277
Gene Namepleckstrin homology like domain, family B, member 3
SynonymsEG232970, Gm10102
MMRRC Submission 041065-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R4249 (G1)
Quality Score225
Status Not validated
Chromosomal Location24610763-24629297 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24627320 bp
Amino Acid Change Isoleucine to Threonine at position 591 (I591T)
Ref Sequence ENSEMBL: ENSMUSP00000146187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073325] [ENSMUST00000206422]
Predicted Effect probably damaging
Transcript: ENSMUST00000073325
AA Change: I591T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073047
Gene: ENSMUSG00000074277
AA Change: I591T

low complexity region 34 47 N/A INTRINSIC
low complexity region 61 74 N/A INTRINSIC
coiled coil region 111 302 N/A INTRINSIC
low complexity region 364 374 N/A INTRINSIC
Blast:PH 389 447 2e-29 BLAST
Blast:PH 457 488 4e-6 BLAST
low complexity region 490 514 N/A INTRINSIC
PH 541 645 1.54e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205857
Predicted Effect probably damaging
Transcript: ENSMUST00000206422
AA Change: I591T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
Ankrd39 A G 1: 36,547,155 S11P probably benign Het
Aox2 A G 1: 58,299,819 S324G probably benign Het
Atl3 T C 19: 7,532,338 V477A probably benign Het
Bcar1 T C 8: 111,720,893 T151A probably benign Het
Cdc42bpg A G 19: 6,315,266 T718A possibly damaging Het
Col9a1 C T 1: 24,244,381 R843C probably damaging Het
Dnah12 T A 14: 26,709,186 D316E possibly damaging Het
Fat2 A G 11: 55,284,301 V1862A probably damaging Het
Fbxw5 C A 2: 25,503,460 N233K probably damaging Het
Fcer2a A G 8: 3,688,831 F75L probably benign Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Gimd1 T C 3: 132,644,408 V144A possibly damaging Het
Glt1d1 T C 5: 127,691,112 probably null Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Kansl1l C T 1: 66,773,478 D459N probably damaging Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Muc4 T C 16: 32,755,826 probably benign Het
Myom1 T A 17: 71,092,140 V999E probably damaging Het
Nckap5 A G 1: 126,027,639 L460P probably benign Het
Olfr109 T C 17: 37,466,824 M206T probably damaging Het
Phf13 A T 4: 151,992,095 N213K probably damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Plekhh2 A G 17: 84,586,337 E860G possibly damaging Het
Rest A G 5: 77,282,112 T793A probably benign Het
Ropn1 C T 16: 34,678,456 Q205* probably null Het
Sacs A C 14: 61,203,457 K984T probably benign Het
Samd11 G A 4: 156,250,486 R102C probably damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Shank1 C A 7: 44,319,736 H352N unknown Het
Slc22a27 A T 19: 7,925,879 I162K possibly damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Tln1 A T 4: 43,536,104 V2027E probably damaging Het
Trdn A G 10: 33,450,998 I594M probably benign Het
Trim5 C G 7: 104,276,815 E180Q possibly damaging Het
Tsen2 A G 6: 115,547,824 probably benign Het
Tubb1 A T 2: 174,455,733 E45V probably null Het
Vmn2r67 T A 7: 85,150,514 probably null Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 121,604,292 probably benign Het
Zfp160 T A 17: 21,025,738 F183L probably benign Het
Other mutations in Phldb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Phldb3 APN 7 24628870 missense probably damaging 1.00
IGL01683:Phldb3 APN 7 24619437 missense possibly damaging 0.71
IGL01732:Phldb3 APN 7 24627326 missense probably damaging 1.00
IGL01765:Phldb3 APN 7 24617375 missense possibly damaging 0.55
IGL03103:Phldb3 APN 7 24624176 missense possibly damaging 0.71
FR4548:Phldb3 UTSW 7 24628978 makesense probably null
R0052:Phldb3 UTSW 7 24612579 missense probably benign 0.01
R0230:Phldb3 UTSW 7 24612579 missense probably benign 0.01
R0234:Phldb3 UTSW 7 24612579 missense probably benign 0.01
R0655:Phldb3 UTSW 7 24624372 missense probably benign 0.07
R1731:Phldb3 UTSW 7 24619235 missense probably benign 0.10
R1935:Phldb3 UTSW 7 24617407 missense probably benign 0.01
R1936:Phldb3 UTSW 7 24617407 missense probably benign 0.01
R2155:Phldb3 UTSW 7 24612645 missense probably damaging 1.00
R2410:Phldb3 UTSW 7 24624294 missense probably benign 0.01
R4501:Phldb3 UTSW 7 24612561 missense probably benign
R4665:Phldb3 UTSW 7 24611427 missense probably benign 0.00
R4916:Phldb3 UTSW 7 24624291 missense probably benign
R4970:Phldb3 UTSW 7 24624685 missense possibly damaging 0.73
R5017:Phldb3 UTSW 7 24620096 missense probably damaging 1.00
R5112:Phldb3 UTSW 7 24624685 missense possibly damaging 0.73
R5864:Phldb3 UTSW 7 24624146 missense possibly damaging 0.55
R5881:Phldb3 UTSW 7 24626722 critical splice donor site probably null
R6176:Phldb3 UTSW 7 24626702 missense probably damaging 1.00
R6756:Phldb3 UTSW 7 24627331 missense probably damaging 1.00
R6800:Phldb3 UTSW 7 24624152 missense possibly damaging 0.93
R7223:Phldb3 UTSW 7 24624653 missense probably benign
R7485:Phldb3 UTSW 7 24611264 start gained probably benign
R7707:Phldb3 UTSW 7 24626597 missense possibly damaging 0.80
R8094:Phldb3 UTSW 7 24626709 missense probably damaging 1.00
R8437:Phldb3 UTSW 7 24628950 missense probably damaging 1.00
RF010:Phldb3 UTSW 7 24626495 frame shift probably null
RF031:Phldb3 UTSW 7 24626493 frame shift probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-06-12