Incidental Mutation 'R4249:Vmn2r67'
ID320534
Institutional Source Beutler Lab
Gene Symbol Vmn2r67
Ensembl Gene ENSMUSG00000095664
Gene Namevomeronasal 2, receptor 67
SynonymsEG620672
MMRRC Submission 041065-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R4249 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location85136240-85155902 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to A at 85150514 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168730]
Predicted Effect probably null
Transcript: ENSMUST00000168730
SMART Domains Protein: ENSMUSP00000126007
Gene: ENSMUSG00000095664

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ANF_receptor 77 464 2.1e-31 PFAM
Pfam:NCD3G 507 559 4.8e-19 PFAM
Pfam:7tm_3 590 827 1.4e-53 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
Ankrd39 A G 1: 36,547,155 S11P probably benign Het
Aox2 A G 1: 58,299,819 S324G probably benign Het
Atl3 T C 19: 7,532,338 V477A probably benign Het
Bcar1 T C 8: 111,720,893 T151A probably benign Het
Cdc42bpg A G 19: 6,315,266 T718A possibly damaging Het
Col9a1 C T 1: 24,244,381 R843C probably damaging Het
Dnah12 T A 14: 26,709,186 D316E possibly damaging Het
Fat2 A G 11: 55,284,301 V1862A probably damaging Het
Fbxw5 C A 2: 25,503,460 N233K probably damaging Het
Fcer2a A G 8: 3,688,831 F75L probably benign Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Gimd1 T C 3: 132,644,408 V144A possibly damaging Het
Glt1d1 T C 5: 127,691,112 probably null Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Kansl1l C T 1: 66,773,478 D459N probably damaging Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Muc4 T C 16: 32,755,826 probably benign Het
Myom1 T A 17: 71,092,140 V999E probably damaging Het
Nckap5 A G 1: 126,027,639 L460P probably benign Het
Olfr109 T C 17: 37,466,824 M206T probably damaging Het
Phf13 A T 4: 151,992,095 N213K probably damaging Het
Phldb3 T C 7: 24,627,320 I591T probably damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Plekhh2 A G 17: 84,586,337 E860G possibly damaging Het
Rest A G 5: 77,282,112 T793A probably benign Het
Ropn1 C T 16: 34,678,456 Q205* probably null Het
Sacs A C 14: 61,203,457 K984T probably benign Het
Samd11 G A 4: 156,250,486 R102C probably damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Shank1 C A 7: 44,319,736 H352N unknown Het
Slc22a27 A T 19: 7,925,879 I162K possibly damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Tln1 A T 4: 43,536,104 V2027E probably damaging Het
Trdn A G 10: 33,450,998 I594M probably benign Het
Trim5 C G 7: 104,276,815 E180Q possibly damaging Het
Tsen2 A G 6: 115,547,824 probably benign Het
Tubb1 A T 2: 174,455,733 E45V probably null Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 121,604,292 probably benign Het
Zfp160 T A 17: 21,025,738 F183L probably benign Het
Other mutations in Vmn2r67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Vmn2r67 APN 7 85151930 missense probably damaging 1.00
IGL01346:Vmn2r67 APN 7 85136919 missense probably damaging 1.00
IGL01373:Vmn2r67 APN 7 85136626 missense probably benign 0.10
IGL01674:Vmn2r67 APN 7 85136443 missense probably damaging 1.00
IGL01978:Vmn2r67 APN 7 85151441 critical splice donor site probably null
IGL02013:Vmn2r67 APN 7 85151655 missense probably benign 0.09
IGL02115:Vmn2r67 APN 7 85151579 missense probably damaging 0.99
IGL02250:Vmn2r67 APN 7 85155800 missense probably benign
IGL02252:Vmn2r67 APN 7 85155800 missense probably benign
IGL02328:Vmn2r67 APN 7 85150690 missense probably benign 0.41
IGL02740:Vmn2r67 APN 7 85136610 missense probably damaging 1.00
IGL02940:Vmn2r67 APN 7 85136743 missense probably benign 0.07
IGL03237:Vmn2r67 APN 7 85149910 missense probably damaging 1.00
R0512:Vmn2r67 UTSW 7 85150692 missense probably damaging 1.00
R1029:Vmn2r67 UTSW 7 85136766 missense probably damaging 1.00
R1193:Vmn2r67 UTSW 7 85151445 missense probably damaging 0.98
R1282:Vmn2r67 UTSW 7 85136724 missense probably benign
R1416:Vmn2r67 UTSW 7 85151616 missense probably benign 0.06
R1429:Vmn2r67 UTSW 7 85152823 missense possibly damaging 0.65
R1462:Vmn2r67 UTSW 7 85155838 missense probably benign 0.00
R1462:Vmn2r67 UTSW 7 85155838 missense probably benign 0.00
R1970:Vmn2r67 UTSW 7 85151805 missense probably benign
R2229:Vmn2r67 UTSW 7 85152042 missense probably benign 0.21
R2246:Vmn2r67 UTSW 7 85136556 missense probably damaging 1.00
R2262:Vmn2r67 UTSW 7 85136974 missense probably damaging 0.96
R2398:Vmn2r67 UTSW 7 85136713 missense probably damaging 1.00
R4666:Vmn2r67 UTSW 7 85150623 missense probably benign
R4669:Vmn2r67 UTSW 7 85150524 missense probably benign 0.11
R4966:Vmn2r67 UTSW 7 85136385 missense probably damaging 1.00
R5264:Vmn2r67 UTSW 7 85152245 missense probably damaging 1.00
R5296:Vmn2r67 UTSW 7 85137022 missense probably damaging 1.00
R5327:Vmn2r67 UTSW 7 85136490 missense probably damaging 1.00
R5401:Vmn2r67 UTSW 7 85136557 missense probably damaging 1.00
R5510:Vmn2r67 UTSW 7 85151815 missense probably benign 0.39
R5574:Vmn2r67 UTSW 7 85151891 missense probably benign 0.00
R5643:Vmn2r67 UTSW 7 85149943 nonsense probably null
R5914:Vmn2r67 UTSW 7 85151836 missense probably damaging 1.00
R6248:Vmn2r67 UTSW 7 85150560 missense probably damaging 0.99
R6291:Vmn2r67 UTSW 7 85149934 missense possibly damaging 0.88
R6309:Vmn2r67 UTSW 7 85151916 missense probably benign
R6442:Vmn2r67 UTSW 7 85155838 missense possibly damaging 0.82
R6665:Vmn2r67 UTSW 7 85136692 missense probably benign 0.07
R6701:Vmn2r67 UTSW 7 85152815 missense probably damaging 1.00
R6848:Vmn2r67 UTSW 7 85152632 missense probably benign 0.00
R6852:Vmn2r67 UTSW 7 85152153 missense probably damaging 0.99
R6991:Vmn2r67 UTSW 7 85155745 missense possibly damaging 0.55
R7143:Vmn2r67 UTSW 7 85152638 missense probably benign
R7197:Vmn2r67 UTSW 7 85136566 missense possibly damaging 0.77
R7393:Vmn2r67 UTSW 7 85155878 missense probably null 0.87
R7420:Vmn2r67 UTSW 7 85136736 missense possibly damaging 0.52
R7622:Vmn2r67 UTSW 7 85136454 missense probably damaging 1.00
R7664:Vmn2r67 UTSW 7 85155811 missense probably benign 0.21
R7665:Vmn2r67 UTSW 7 85151988 nonsense probably null
R7896:Vmn2r67 UTSW 7 85136712 missense probably damaging 1.00
R7913:Vmn2r67 UTSW 7 85151828 missense possibly damaging 0.87
R8026:Vmn2r67 UTSW 7 85136716 missense probably damaging 1.00
R8114:Vmn2r67 UTSW 7 85155889 missense probably benign 0.01
R8317:Vmn2r67 UTSW 7 85136626 missense probably benign 0.10
R8363:Vmn2r67 UTSW 7 85155761 missense probably benign 0.00
R8421:Vmn2r67 UTSW 7 85136685 missense probably damaging 0.98
R8444:Vmn2r67 UTSW 7 85136646 missense probably benign 0.01
R8751:Vmn2r67 UTSW 7 85152242 missense probably benign 0.01
R8810:Vmn2r67 UTSW 7 85137138 missense not run
R8811:Vmn2r67 UTSW 7 85150687 missense not run
Predicted Primers PCR Primer
(F):5'- TGGAAGACCTGGTTTAACACAC -3'
(R):5'- CTGGAGACCTAGTCAACATGAACC -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTCGGGAG -3'
(R):5'- CCTAGTCAACATGAACCAGAATTTG -3'
Posted On2015-06-12