Incidental Mutation 'R4249:Trim5'
ID320535
Institutional Source Beutler Lab
Gene Symbol Trim5
Ensembl Gene ENSMUSG00000060441
Gene Nametripartite motif-containing 5
Synonyms
MMRRC Submission 041065-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R4249 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104263386-104288094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 104276815 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 180 (E180Q)
Ref Sequence ENSEMBL: ENSMUSP00000050084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051795] [ENSMUST00000098179]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051795
AA Change: E180Q

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050084
Gene: ENSMUSG00000060441
AA Change: E180Q

DomainStartEndE-ValueType
RING 15 58 3.64e-7 SMART
BBOX 91 132 4.83e-12 SMART
coiled coil region 172 232 N/A INTRINSIC
Pfam:SPRY 349 485 9.2e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000098179
AA Change: E180Q

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000095781
Gene: ENSMUSG00000060441
AA Change: E180Q

DomainStartEndE-ValueType
RING 15 58 3.64e-7 SMART
BBOX 91 132 4.83e-12 SMART
Pfam:SPRY 351 493 1.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138557
AA Change: E180Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000119127
Gene: ENSMUSG00000060441
AA Change: E180Q

DomainStartEndE-ValueType
RING 15 58 3.64e-7 SMART
BBOX 91 132 4.83e-12 SMART
coiled coil region 173 232 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
Ankrd39 A G 1: 36,547,155 S11P probably benign Het
Aox2 A G 1: 58,299,819 S324G probably benign Het
Atl3 T C 19: 7,532,338 V477A probably benign Het
Bcar1 T C 8: 111,720,893 T151A probably benign Het
Cdc42bpg A G 19: 6,315,266 T718A possibly damaging Het
Col9a1 C T 1: 24,244,381 R843C probably damaging Het
Dnah12 T A 14: 26,709,186 D316E possibly damaging Het
Fat2 A G 11: 55,284,301 V1862A probably damaging Het
Fbxw5 C A 2: 25,503,460 N233K probably damaging Het
Fcer2a A G 8: 3,688,831 F75L probably benign Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Gimd1 T C 3: 132,644,408 V144A possibly damaging Het
Glt1d1 T C 5: 127,691,112 probably null Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Kansl1l C T 1: 66,773,478 D459N probably damaging Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Muc4 T C 16: 32,755,826 probably benign Het
Myom1 T A 17: 71,092,140 V999E probably damaging Het
Nckap5 A G 1: 126,027,639 L460P probably benign Het
Olfr109 T C 17: 37,466,824 M206T probably damaging Het
Phf13 A T 4: 151,992,095 N213K probably damaging Het
Phldb3 T C 7: 24,627,320 I591T probably damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Plekhh2 A G 17: 84,586,337 E860G possibly damaging Het
Rest A G 5: 77,282,112 T793A probably benign Het
Ropn1 C T 16: 34,678,456 Q205* probably null Het
Sacs A C 14: 61,203,457 K984T probably benign Het
Samd11 G A 4: 156,250,486 R102C probably damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Shank1 C A 7: 44,319,736 H352N unknown Het
Slc22a27 A T 19: 7,925,879 I162K possibly damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Tln1 A T 4: 43,536,104 V2027E probably damaging Het
Trdn A G 10: 33,450,998 I594M probably benign Het
Tsen2 A G 6: 115,547,824 probably benign Het
Tubb1 A T 2: 174,455,733 E45V probably null Het
Vmn2r67 T A 7: 85,150,514 probably null Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 121,604,292 probably benign Het
Zfp160 T A 17: 21,025,738 F183L probably benign Het
Other mutations in Trim5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01702:Trim5 APN 7 104279431 missense probably damaging 1.00
IGL02165:Trim5 APN 7 104279359 missense probably damaging 1.00
IGL02576:Trim5 APN 7 104278417 missense probably damaging 0.97
IGL02660:Trim5 APN 7 104266218 missense probably damaging 0.96
IGL02732:Trim5 APN 7 104278465 missense probably benign 0.02
R0278:Trim5 UTSW 7 104279675 missense probably benign 0.00
R0373:Trim5 UTSW 7 104265684 missense probably benign 0.00
R0508:Trim5 UTSW 7 104265604 missense probably null 0.98
R0840:Trim5 UTSW 7 104265771 missense probably damaging 1.00
R0947:Trim5 UTSW 7 104265751 missense probably damaging 1.00
R1432:Trim5 UTSW 7 104279519 missense probably benign 0.04
R1432:Trim5 UTSW 7 104279521 missense probably benign
R1770:Trim5 UTSW 7 104276661 missense probably damaging 1.00
R1782:Trim5 UTSW 7 104265816 splice site probably null
R1988:Trim5 UTSW 7 104265621 missense probably damaging 0.99
R2140:Trim5 UTSW 7 104276791 nonsense probably null
R3110:Trim5 UTSW 7 104279638 missense probably damaging 1.00
R3112:Trim5 UTSW 7 104279638 missense probably damaging 1.00
R3893:Trim5 UTSW 7 104276835 missense probably damaging 0.98
R3948:Trim5 UTSW 7 104266520 nonsense probably null
R4114:Trim5 UTSW 7 104265740 missense probably damaging 0.99
R4352:Trim5 UTSW 7 104276808 missense probably damaging 1.00
R4595:Trim5 UTSW 7 104265432 missense probably damaging 1.00
R5057:Trim5 UTSW 7 104265423 missense probably damaging 1.00
R5583:Trim5 UTSW 7 104276835 missense probably damaging 0.98
R5861:Trim5 UTSW 7 104279519 missense probably benign 0.04
R5861:Trim5 UTSW 7 104279521 missense probably benign
R7027:Trim5 UTSW 7 104265668 missense probably benign 0.00
R7078:Trim5 UTSW 7 104278474 missense possibly damaging 0.85
R7150:Trim5 UTSW 7 104276810 missense probably damaging 0.96
R7657:Trim5 UTSW 7 104276677 missense possibly damaging 0.51
R7660:Trim5 UTSW 7 104279362 missense probably damaging 1.00
R7737:Trim5 UTSW 7 104279564 missense probably damaging 1.00
R7821:Trim5 UTSW 7 104278426 missense probably benign 0.32
R7861:Trim5 UTSW 7 104266468 critical splice donor site probably null
R8167:Trim5 UTSW 7 104278423 missense probably damaging 0.99
R8220:Trim5 UTSW 7 104276826 missense probably damaging 0.96
R8296:Trim5 UTSW 7 104265786 missense probably damaging 1.00
R8555:Trim5 UTSW 7 104278123 splice site probably null
Z1088:Trim5 UTSW 7 104266225 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ACCTTGTGCAGCCTTACCTG -3'
(R):5'- AGGCTATCCAAGATTCCCTAAGAATC -3'

Sequencing Primer
(F):5'- GAGCACTGTAACTGATGTTCCAC -3'
(R):5'- ATGATGGAGCAGGCTTCCAATCTC -3'
Posted On2015-06-12