Incidental Mutation 'R4249:Fcer2a'
ID320536
Institutional Source Beutler Lab
Gene Symbol Fcer2a
Ensembl Gene ENSMUSG00000005540
Gene NameFc receptor, IgE, low affinity II, alpha polypeptide
SynonymsLy-42, FC epsilon RII, CD23, Fce2, low-affinity IgE receptor
MMRRC Submission 041065-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4249 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location3681737-3694175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3688831 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 75 (F75L)
Ref Sequence ENSEMBL: ENSMUSP00000146568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005678] [ENSMUST00000207463] [ENSMUST00000207635] [ENSMUST00000208145] [ENSMUST00000208438] [ENSMUST00000208492] [ENSMUST00000208603]
Predicted Effect probably benign
Transcript: ENSMUST00000005678
AA Change: F76L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005678
Gene: ENSMUSG00000005540
AA Change: F76L

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
coiled coil region 80 150 N/A INTRINSIC
CLECT 186 306 2.11e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207327
Predicted Effect probably benign
Transcript: ENSMUST00000207463
AA Change: F36L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000207635
AA Change: F49L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208145
AA Change: F75L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000208438
AA Change: F75L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208492
AA Change: F75L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000208603
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a B-cell specific antigen, and a low-affinity receptor for IgE. It has essential roles in B cell growth and differentiation, and the regulation of IgE production. This protein also exists as a soluble secreted form, then functioning as a potent mitogenic growth factor. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for mutations in this gene are essentially normal although IgE levels or IgE mediated responses may be abnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
Ankrd39 A G 1: 36,547,155 S11P probably benign Het
Aox2 A G 1: 58,299,819 S324G probably benign Het
Atl3 T C 19: 7,532,338 V477A probably benign Het
Bcar1 T C 8: 111,720,893 T151A probably benign Het
Cdc42bpg A G 19: 6,315,266 T718A possibly damaging Het
Col9a1 C T 1: 24,244,381 R843C probably damaging Het
Dnah12 T A 14: 26,709,186 D316E possibly damaging Het
Fat2 A G 11: 55,284,301 V1862A probably damaging Het
Fbxw5 C A 2: 25,503,460 N233K probably damaging Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Gimd1 T C 3: 132,644,408 V144A possibly damaging Het
Glt1d1 T C 5: 127,691,112 probably null Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Kansl1l C T 1: 66,773,478 D459N probably damaging Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Muc4 T C 16: 32,755,826 probably benign Het
Myom1 T A 17: 71,092,140 V999E probably damaging Het
Nckap5 A G 1: 126,027,639 L460P probably benign Het
Olfr109 T C 17: 37,466,824 M206T probably damaging Het
Phf13 A T 4: 151,992,095 N213K probably damaging Het
Phldb3 T C 7: 24,627,320 I591T probably damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Plekhh2 A G 17: 84,586,337 E860G possibly damaging Het
Rest A G 5: 77,282,112 T793A probably benign Het
Ropn1 C T 16: 34,678,456 Q205* probably null Het
Sacs A C 14: 61,203,457 K984T probably benign Het
Samd11 G A 4: 156,250,486 R102C probably damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Shank1 C A 7: 44,319,736 H352N unknown Het
Slc22a27 A T 19: 7,925,879 I162K possibly damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Tln1 A T 4: 43,536,104 V2027E probably damaging Het
Trdn A G 10: 33,450,998 I594M probably benign Het
Trim5 C G 7: 104,276,815 E180Q possibly damaging Het
Tsen2 A G 6: 115,547,824 probably benign Het
Tubb1 A T 2: 174,455,733 E45V probably null Het
Vmn2r67 T A 7: 85,150,514 probably null Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 121,604,292 probably benign Het
Zfp160 T A 17: 21,025,738 F183L probably benign Het
Other mutations in Fcer2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Fcer2a APN 8 3688842 missense possibly damaging 0.94
IGL01458:Fcer2a APN 8 3688151 missense probably benign 0.45
IGL01545:Fcer2a APN 8 3683598 nonsense probably null
IGL01994:Fcer2a APN 8 3688302 missense possibly damaging 0.94
IGL03340:Fcer2a APN 8 3688310 missense possibly damaging 0.75
anemone UTSW 8 3688796 critical splice donor site probably null
R0058:Fcer2a UTSW 8 3688111 splice site probably benign
R0058:Fcer2a UTSW 8 3688111 splice site probably benign
R0241:Fcer2a UTSW 8 3688796 critical splice donor site probably null
R0241:Fcer2a UTSW 8 3688796 critical splice donor site probably null
R0276:Fcer2a UTSW 8 3689811 missense possibly damaging 0.89
R1530:Fcer2a UTSW 8 3682976 missense probably damaging 0.98
R2202:Fcer2a UTSW 8 3688557 missense possibly damaging 0.72
R4133:Fcer2a UTSW 8 3691130 missense possibly damaging 0.60
R4273:Fcer2a UTSW 8 3682848 missense possibly damaging 0.81
R4506:Fcer2a UTSW 8 3688603 splice site probably null
R6796:Fcer2a UTSW 8 3689830 missense possibly damaging 0.92
R6861:Fcer2a UTSW 8 3682910 missense probably damaging 0.98
R7421:Fcer2a UTSW 8 3690335 missense probably benign
R7795:Fcer2a UTSW 8 3682910 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAAGGTTCCTGGAGAGTGTC -3'
(R):5'- CCCAACCTTAACTGGATGCC -3'

Sequencing Primer
(F):5'- TTCCTGGAGAGTGTCCCCTG -3'
(R):5'- ACCTTAACTGGATGCCTTAACTGGG -3'
Posted On2015-06-12