Incidental Mutation 'R4249:Zcchc14'
ID320538
Institutional Source Beutler Lab
Gene Symbol Zcchc14
Ensembl Gene ENSMUSG00000061410
Gene Namezinc finger, CCHC domain containing 14
SynonymsBdg29
MMRRC Submission 041065-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4249 (G1)
Quality Score217
Status Not validated
Chromosome8
Chromosomal Location121598703-121652901 bp(-) (GRCm38)
Type of Mutationsmall deletion (4 aa in frame mutation)
DNA Base Change (assembly) CTGATGGTGGTGGTGATGGTGGTGG to CTGATGGTGGTGG at 121604292 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000046386] [ENSMUST00000127664]
Predicted Effect probably benign
Transcript: ENSMUST00000046386
SMART Domains Protein: ENSMUSP00000040360
Gene: ENSMUSG00000061410

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
low complexity region 129 145 N/A INTRINSIC
low complexity region 206 225 N/A INTRINSIC
low complexity region 246 265 N/A INTRINSIC
Blast:SAM 299 349 2e-25 BLAST
SCOP:d1kw4a_ 307 358 1e-6 SMART
low complexity region 422 432 N/A INTRINSIC
low complexity region 438 454 N/A INTRINSIC
low complexity region 532 543 N/A INTRINSIC
low complexity region 709 790 N/A INTRINSIC
low complexity region 791 808 N/A INTRINSIC
ZnF_C2HC 914 930 3.44e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139379
Predicted Effect probably benign
Transcript: ENSMUST00000154725
SMART Domains Protein: ENSMUSP00000120570
Gene: ENSMUSG00000061410

DomainStartEndE-ValueType
low complexity region 7 88 N/A INTRINSIC
low complexity region 89 106 N/A INTRINSIC
ZnF_C2HC 212 228 3.44e-4 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
Ankrd39 A G 1: 36,547,155 S11P probably benign Het
Aox2 A G 1: 58,299,819 S324G probably benign Het
Atl3 T C 19: 7,532,338 V477A probably benign Het
Bcar1 T C 8: 111,720,893 T151A probably benign Het
Cdc42bpg A G 19: 6,315,266 T718A possibly damaging Het
Col9a1 C T 1: 24,244,381 R843C probably damaging Het
Dnah12 T A 14: 26,709,186 D316E possibly damaging Het
Fat2 A G 11: 55,284,301 V1862A probably damaging Het
Fbxw5 C A 2: 25,503,460 N233K probably damaging Het
Fcer2a A G 8: 3,688,831 F75L probably benign Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Gimd1 T C 3: 132,644,408 V144A possibly damaging Het
Glt1d1 T C 5: 127,691,112 probably null Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Kansl1l C T 1: 66,773,478 D459N probably damaging Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Muc4 T C 16: 32,755,826 probably benign Het
Myom1 T A 17: 71,092,140 V999E probably damaging Het
Nckap5 A G 1: 126,027,639 L460P probably benign Het
Olfr109 T C 17: 37,466,824 M206T probably damaging Het
Phf13 A T 4: 151,992,095 N213K probably damaging Het
Phldb3 T C 7: 24,627,320 I591T probably damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Plekhh2 A G 17: 84,586,337 E860G possibly damaging Het
Rest A G 5: 77,282,112 T793A probably benign Het
Ropn1 C T 16: 34,678,456 Q205* probably null Het
Sacs A C 14: 61,203,457 K984T probably benign Het
Samd11 G A 4: 156,250,486 R102C probably damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Shank1 C A 7: 44,319,736 H352N unknown Het
Slc22a27 A T 19: 7,925,879 I162K possibly damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Tln1 A T 4: 43,536,104 V2027E probably damaging Het
Trdn A G 10: 33,450,998 I594M probably benign Het
Trim5 C G 7: 104,276,815 E180Q possibly damaging Het
Tsen2 A G 6: 115,547,824 probably benign Het
Tubb1 A T 2: 174,455,733 E45V probably null Het
Vmn2r67 T A 7: 85,150,514 probably null Het
Zfp160 T A 17: 21,025,738 F183L probably benign Het
Other mutations in Zcchc14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02035:Zcchc14 APN 8 121604615 unclassified probably benign
IGL02060:Zcchc14 APN 8 121603895 missense probably damaging 0.98
IGL02455:Zcchc14 APN 8 121606270 unclassified probably benign
IGL03196:Zcchc14 APN 8 121609138 unclassified probably benign
P0033:Zcchc14 UTSW 8 121610159 intron probably benign
R0483:Zcchc14 UTSW 8 121628649 intron probably benign
R0639:Zcchc14 UTSW 8 121605449 nonsense probably null
R1013:Zcchc14 UTSW 8 121606925 unclassified probably benign
R1129:Zcchc14 UTSW 8 121608415 unclassified probably benign
R1546:Zcchc14 UTSW 8 121604263 intron probably benign
R1563:Zcchc14 UTSW 8 121603979 missense probably benign 0.10
R1861:Zcchc14 UTSW 8 121609251 unclassified probably benign
R2200:Zcchc14 UTSW 8 121605428 unclassified probably benign
R2419:Zcchc14 UTSW 8 121603936 missense probably damaging 0.99
R4246:Zcchc14 UTSW 8 121604292 small deletion probably benign
R4424:Zcchc14 UTSW 8 121651941 intron probably benign
R4470:Zcchc14 UTSW 8 121651759 intron probably benign
R4520:Zcchc14 UTSW 8 121609095 unclassified probably benign
R4681:Zcchc14 UTSW 8 121608600 unclassified probably benign
R5253:Zcchc14 UTSW 8 121618694 intron probably benign
R5314:Zcchc14 UTSW 8 121608598 unclassified probably benign
R5591:Zcchc14 UTSW 8 121605448 unclassified probably benign
R5746:Zcchc14 UTSW 8 121604639 unclassified probably benign
R5781:Zcchc14 UTSW 8 121604593 unclassified probably benign
R5897:Zcchc14 UTSW 8 121605160 unclassified probably benign
R5930:Zcchc14 UTSW 8 121611358 intron probably benign
R5963:Zcchc14 UTSW 8 121628623 intron probably benign
R6364:Zcchc14 UTSW 8 121604859 unclassified probably benign
R6562:Zcchc14 UTSW 8 121604103 missense probably damaging 0.99
R6579:Zcchc14 UTSW 8 121604467 intron probably benign
R6592:Zcchc14 UTSW 8 121604639 unclassified probably benign
R6699:Zcchc14 UTSW 8 121608616 unclassified probably benign
R7195:Zcchc14 UTSW 8 121608461 missense unknown
R7420:Zcchc14 UTSW 8 121651791 intron probably benign
R7490:Zcchc14 UTSW 8 121605017 missense unknown
R7597:Zcchc14 UTSW 8 121608500 missense unknown
R7758:Zcchc14 UTSW 8 121604689 missense unknown
R7773:Zcchc14 UTSW 8 121651775 missense unknown
R7831:Zcchc14 UTSW 8 121605245 missense not run
R7889:Zcchc14 UTSW 8 121604895 missense unknown
R7919:Zcchc14 UTSW 8 121604173 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTACCACAGGAAAGGC -3'
(R):5'- CTTCTTTTGCGAGCATGGCC -3'

Sequencing Primer
(F):5'- CCATACTGCTGGGTACTGACATAG -3'
(R):5'- TGCGAGCATGGCCTCTCTAC -3'
Posted On2015-06-12