Incidental Mutation 'R4249:Pik3cb'
ID320539
Institutional Source Beutler Lab
Gene Symbol Pik3cb
Ensembl Gene ENSMUSG00000032462
Gene Namephosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta
Synonymsp110beta, 1110001J02Rik
MMRRC Submission 041065-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R4249 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location99036654-99140621 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 99101176 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035037] [ENSMUST00000124723] [ENSMUST00000136965]
PDB Structure CRYSTAL STRUCTURE OF P110BETA IN COMPLEX WITH ICSH2 OF P85BETA AND THE DRUG GDC-0941 [X-RAY DIFFRACTION]
Discovery and Optimization of Pyrimidone Indoline Amide PI3Kbeta Inhibitors for the Treatment of Phosphatase and TENsin homologue (PTEN)-Deficient Cancers [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000035037
SMART Domains Protein: ENSMUSP00000035037
Gene: ENSMUSG00000032462

DomainStartEndE-ValueType
PI3K_p85B 35 112 2.44e-50 SMART
PI3K_rbd 174 282 1.88e-42 SMART
low complexity region 305 311 N/A INTRINSIC
PI3K_C2 315 417 4.64e-33 SMART
PI3Ka 519 705 1.08e-92 SMART
PI3Kc 795 1061 8.75e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124723
SMART Domains Protein: ENSMUSP00000121466
Gene: ENSMUSG00000032462

DomainStartEndE-ValueType
Pfam:PI3K_p85B 35 68 3.6e-14 PFAM
Predicted Effect silent
Transcript: ENSMUST00000136965
SMART Domains Protein: ENSMUSP00000138346
Gene: ENSMUSG00000032462

DomainStartEndE-ValueType
PI3K_p85B 35 112 2.44e-50 SMART
PI3K_rbd 174 282 1.88e-42 SMART
low complexity region 305 311 N/A INTRINSIC
PI3K_C2 315 417 4.64e-33 SMART
Blast:PI3Ka 450 520 1e-37 BLAST
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an isoform of the catalytic subunit of phosphoinositide 3-kinase (PI3K). These kinases are important in signaling pathways involving receptors on the outer membrane of eukaryotic cells and are named for their catalytic subunit. The encoded protein is the catalytic subunit for PI3Kbeta (PI3KB). PI3KB has been shown to be part of the activation pathway in neutrophils which have bound immune complexes at sites of injury or infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit 30% fetal lethality, decreased size at birth and postnatally, abnormal glucose homeostasis, and dyslipidemia. Mice homozygous for a different knock-out allele die prior to E8.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
Ankrd39 A G 1: 36,547,155 S11P probably benign Het
Aox2 A G 1: 58,299,819 S324G probably benign Het
Atl3 T C 19: 7,532,338 V477A probably benign Het
Bcar1 T C 8: 111,720,893 T151A probably benign Het
Cdc42bpg A G 19: 6,315,266 T718A possibly damaging Het
Col9a1 C T 1: 24,244,381 R843C probably damaging Het
Dnah12 T A 14: 26,709,186 D316E possibly damaging Het
Fat2 A G 11: 55,284,301 V1862A probably damaging Het
Fbxw5 C A 2: 25,503,460 N233K probably damaging Het
Fcer2a A G 8: 3,688,831 F75L probably benign Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Gimd1 T C 3: 132,644,408 V144A possibly damaging Het
Glt1d1 T C 5: 127,691,112 probably null Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Kansl1l C T 1: 66,773,478 D459N probably damaging Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Muc4 T C 16: 32,755,826 probably benign Het
Myom1 T A 17: 71,092,140 V999E probably damaging Het
Nckap5 A G 1: 126,027,639 L460P probably benign Het
Olfr109 T C 17: 37,466,824 M206T probably damaging Het
Phf13 A T 4: 151,992,095 N213K probably damaging Het
Phldb3 T C 7: 24,627,320 I591T probably damaging Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Plekhh2 A G 17: 84,586,337 E860G possibly damaging Het
Rest A G 5: 77,282,112 T793A probably benign Het
Ropn1 C T 16: 34,678,456 Q205* probably null Het
Sacs A C 14: 61,203,457 K984T probably benign Het
Samd11 G A 4: 156,250,486 R102C probably damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Shank1 C A 7: 44,319,736 H352N unknown Het
Slc22a27 A T 19: 7,925,879 I162K possibly damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Tln1 A T 4: 43,536,104 V2027E probably damaging Het
Trdn A G 10: 33,450,998 I594M probably benign Het
Trim5 C G 7: 104,276,815 E180Q possibly damaging Het
Tsen2 A G 6: 115,547,824 probably benign Het
Tubb1 A T 2: 174,455,733 E45V probably null Het
Vmn2r67 T A 7: 85,150,514 probably null Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 121,604,292 probably benign Het
Zfp160 T A 17: 21,025,738 F183L probably benign Het
Other mutations in Pik3cb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Pik3cb APN 9 99101286 missense probably damaging 0.96
IGL01354:Pik3cb APN 9 99064168 missense possibly damaging 0.83
IGL02132:Pik3cb APN 9 99071377 missense probably benign 0.01
IGL02268:Pik3cb APN 9 99046556 missense probably benign 0.00
IGL02376:Pik3cb APN 9 99052352 missense probably benign 0.00
IGL02378:Pik3cb APN 9 99062840 missense probably benign 0.40
IGL02748:Pik3cb APN 9 99062968 splice site probably benign
IGL03038:Pik3cb APN 9 99065597 missense probably damaging 1.00
IGL03142:Pik3cb APN 9 99065562 missense probably benign 0.10
H8786:Pik3cb UTSW 9 99046559 missense possibly damaging 0.80
R0071:Pik3cb UTSW 9 99044865 missense probably benign 0.02
R0071:Pik3cb UTSW 9 99044865 missense probably benign 0.02
R0305:Pik3cb UTSW 9 99064076 missense possibly damaging 0.86
R0464:Pik3cb UTSW 9 99044743 critical splice donor site probably null
R0635:Pik3cb UTSW 9 99064218 splice site probably benign
R1386:Pik3cb UTSW 9 99064027 missense possibly damaging 0.90
R1530:Pik3cb UTSW 9 99053973 missense probably damaging 0.96
R1802:Pik3cb UTSW 9 99101289 nonsense probably null
R1815:Pik3cb UTSW 9 99093095 missense possibly damaging 0.93
R2011:Pik3cb UTSW 9 99105579 nonsense probably null
R2079:Pik3cb UTSW 9 99060204 missense probably benign 0.27
R2153:Pik3cb UTSW 9 99101244 nonsense probably null
R2237:Pik3cb UTSW 9 99041028 missense probably damaging 1.00
R2238:Pik3cb UTSW 9 99041028 missense probably damaging 1.00
R2513:Pik3cb UTSW 9 99061842 missense probably damaging 1.00
R3982:Pik3cb UTSW 9 99046601 missense probably benign 0.06
R4009:Pik3cb UTSW 9 99040929 missense probably damaging 0.98
R4246:Pik3cb UTSW 9 99101176 splice site probably null
R4248:Pik3cb UTSW 9 99101176 splice site probably null
R4334:Pik3cb UTSW 9 99061851 missense probably damaging 1.00
R4544:Pik3cb UTSW 9 99039759 missense probably damaging 1.00
R4568:Pik3cb UTSW 9 99090302 missense probably benign 0.00
R4571:Pik3cb UTSW 9 99090257 missense possibly damaging 0.94
R4595:Pik3cb UTSW 9 99055406 missense possibly damaging 0.95
R4599:Pik3cb UTSW 9 99061764 missense probably benign 0.15
R4820:Pik3cb UTSW 9 99073626 missense probably benign 0.00
R4887:Pik3cb UTSW 9 99101328 missense probably damaging 0.99
R4967:Pik3cb UTSW 9 99105632 missense probably benign 0.14
R5029:Pik3cb UTSW 9 99054060 missense probably damaging 0.98
R5031:Pik3cb UTSW 9 99071408 missense probably damaging 1.00
R5394:Pik3cb UTSW 9 99088663 missense probably benign
R5769:Pik3cb UTSW 9 99093159 nonsense probably null
R6128:Pik3cb UTSW 9 99064099 missense possibly damaging 0.95
R6250:Pik3cb UTSW 9 99094598 missense probably benign 0.01
R6354:Pik3cb UTSW 9 99073643 missense probably benign 0.00
R6370:Pik3cb UTSW 9 99040934 missense probably damaging 1.00
R6664:Pik3cb UTSW 9 99094538 missense possibly damaging 0.56
R6665:Pik3cb UTSW 9 99073649 missense probably benign 0.00
R6751:Pik3cb UTSW 9 99094521 missense probably benign
R6781:Pik3cb UTSW 9 99040992 missense possibly damaging 0.52
R6869:Pik3cb UTSW 9 99060259 missense probably benign 0.08
R6883:Pik3cb UTSW 9 99101400 missense probably benign 0.00
R7150:Pik3cb UTSW 9 99093090 missense probably damaging 1.00
R7446:Pik3cb UTSW 9 99046658 missense probably damaging 1.00
R7679:Pik3cb UTSW 9 99088607 missense probably benign 0.05
R7831:Pik3cb UTSW 9 99088613 missense probably benign
R8300:Pik3cb UTSW 9 99046658 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGAAATGCAGGCCCTTGG -3'
(R):5'- AACTACCCGATGTTTAACCTCC -3'

Sequencing Primer
(F):5'- AGGCCCTTGGGTGCAGAG -3'
(R):5'- CCTCATGGACATTGACTCGTATATG -3'
Posted On2015-06-12