Incidental Mutation 'R4249:Dnah12'
Institutional Source Beutler Lab
Gene Symbol Dnah12
Ensembl Gene ENSMUSG00000021879
Gene Namedynein, axonemal, heavy chain 12
SynonymsDHC3, Hdhc3, HL-19, Dnahc7l, 4921531P07Rik, LOC380889, DLP12, HL19, Dnahc12
MMRRC Submission 041065-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.431) question?
Stock #R4249 (G1)
Quality Score225
Status Not validated
Chromosomal Location26693274-26891703 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26709186 bp
Amino Acid Change Aspartic acid to Glutamic Acid at position 316 (D316E)
Ref Sequence ENSEMBL: ENSMUSP00000022433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022433]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022433
AA Change: D316E

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000022433
Gene: ENSMUSG00000021879
AA Change: D316E

low complexity region 127 140 N/A INTRINSIC
coiled coil region 588 666 N/A INTRINSIC
Pfam:DHC_N2 676 1113 1.1e-147 PFAM
AAA 1268 1407 1.15e0 SMART
Pfam:AAA_5 1552 1695 1.5e-7 PFAM
Blast:AAA 1709 1827 2e-24 BLAST
Blast:AAA 1848 1898 1e-16 BLAST
AAA 1903 2051 5.42e-4 SMART
Pfam:AAA_8 2238 2316 2e-18 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
Ankrd39 A G 1: 36,547,155 S11P probably benign Het
Aox2 A G 1: 58,299,819 S324G probably benign Het
Atl3 T C 19: 7,532,338 V477A probably benign Het
Bcar1 T C 8: 111,720,893 T151A probably benign Het
Cdc42bpg A G 19: 6,315,266 T718A possibly damaging Het
Col9a1 C T 1: 24,244,381 R843C probably damaging Het
Fat2 A G 11: 55,284,301 V1862A probably damaging Het
Fbxw5 C A 2: 25,503,460 N233K probably damaging Het
Fcer2a A G 8: 3,688,831 F75L probably benign Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Gimd1 T C 3: 132,644,408 V144A possibly damaging Het
Glt1d1 T C 5: 127,691,112 probably null Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Kansl1l C T 1: 66,773,478 D459N probably damaging Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Muc4 T C 16: 32,755,826 probably benign Het
Myom1 T A 17: 71,092,140 V999E probably damaging Het
Nckap5 A G 1: 126,027,639 L460P probably benign Het
Olfr109 T C 17: 37,466,824 M206T probably damaging Het
Phf13 A T 4: 151,992,095 N213K probably damaging Het
Phldb3 T C 7: 24,627,320 I591T probably damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Plekhh2 A G 17: 84,586,337 E860G possibly damaging Het
Rest A G 5: 77,282,112 T793A probably benign Het
Ropn1 C T 16: 34,678,456 Q205* probably null Het
Sacs A C 14: 61,203,457 K984T probably benign Het
Samd11 G A 4: 156,250,486 R102C probably damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Shank1 C A 7: 44,319,736 H352N unknown Het
Slc22a27 A T 19: 7,925,879 I162K possibly damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Tln1 A T 4: 43,536,104 V2027E probably damaging Het
Trdn A G 10: 33,450,998 I594M probably benign Het
Trim5 C G 7: 104,276,815 E180Q possibly damaging Het
Tsen2 A G 6: 115,547,824 probably benign Het
Tubb1 A T 2: 174,455,733 E45V probably null Het
Vmn2r67 T A 7: 85,150,514 probably null Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 121,604,292 probably benign Het
Zfp160 T A 17: 21,025,738 F183L probably benign Het
Other mutations in Dnah12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Dnah12 APN 14 26771005 missense probably damaging 1.00
IGL01602:Dnah12 APN 14 26710275 splice site probably benign
IGL01681:Dnah12 APN 14 26722160 missense probably benign
IGL02082:Dnah12 APN 14 26707162 missense possibly damaging 0.79
IGL02140:Dnah12 APN 14 26716577 missense probably benign 0.20
IGL02170:Dnah12 APN 14 26773112 missense probably damaging 0.99
IGL02174:Dnah12 APN 14 26706917 missense probably benign 0.00
IGL02367:Dnah12 APN 14 26709161 missense probably benign 0.30
IGL02418:Dnah12 APN 14 26773722 missense probably damaging 1.00
IGL03039:Dnah12 APN 14 26724512 missense probably benign 0.02
IGL03066:Dnah12 APN 14 26697398 missense probably benign 0.06
drippings UTSW 14 26854804 missense probably damaging 1.00
grueben UTSW 14 26878079 missense probably damaging 1.00
F5770:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
FR4304:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4340:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4342:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4589:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
IGL03055:Dnah12 UTSW 14 26872740 missense probably damaging 1.00
LCD18:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
R0003:Dnah12 UTSW 14 26772644 missense probably damaging 1.00
R0110:Dnah12 UTSW 14 26798899 missense probably damaging 1.00
R0302:Dnah12 UTSW 14 26799999 missense probably damaging 1.00
R0355:Dnah12 UTSW 14 26706117 intron probably null
R0364:Dnah12 UTSW 14 26724473 missense probably benign 0.10
R0469:Dnah12 UTSW 14 26798899 missense probably damaging 1.00
R0558:Dnah12 UTSW 14 26709310 missense probably benign 0.00
R0709:Dnah12 UTSW 14 26884265 splice site probably benign
R0734:Dnah12 UTSW 14 26800013 missense probably benign 0.00
R1273:Dnah12 UTSW 14 26739220 nonsense probably null
R1496:Dnah12 UTSW 14 26710248 missense probably benign
R1503:Dnah12 UTSW 14 26773692 missense probably damaging 1.00
R1535:Dnah12 UTSW 14 26816322 missense possibly damaging 0.91
R1608:Dnah12 UTSW 14 26766190 missense probably damaging 1.00
R1682:Dnah12 UTSW 14 26778883 missense possibly damaging 0.71
R1758:Dnah12 UTSW 14 26766114 missense probably benign 0.02
R1826:Dnah12 UTSW 14 26711019 missense probably benign 0.01
R1829:Dnah12 UTSW 14 26773023 missense probably damaging 1.00
R1829:Dnah12 UTSW 14 26800075 missense probably damaging 1.00
R1862:Dnah12 UTSW 14 26697398 missense probably benign 0.06
R1862:Dnah12 UTSW 14 26709257 missense probably benign 0.30
R1913:Dnah12 UTSW 14 26792264 splice site probably null
R1933:Dnah12 UTSW 14 26734495 missense probably damaging 0.98
R2006:Dnah12 UTSW 14 26814459 missense possibly damaging 0.95
R2045:Dnah12 UTSW 14 26781528 missense probably null 1.00
R2113:Dnah12 UTSW 14 26766141 missense probably damaging 1.00
R2125:Dnah12 UTSW 14 26724458 nonsense probably null
R2126:Dnah12 UTSW 14 26724458 nonsense probably null
R2207:Dnah12 UTSW 14 26781787 missense probably damaging 0.99
R2213:Dnah12 UTSW 14 26739330 missense probably benign 0.06
R2511:Dnah12 UTSW 14 26769950 missense possibly damaging 0.65
R2875:Dnah12 UTSW 14 26693470 missense probably benign 0.04
R2875:Dnah12 UTSW 14 26876950 missense probably benign 0.05
R3551:Dnah12 UTSW 14 26770972 missense probably benign 0.01
R3713:Dnah12 UTSW 14 26812790 missense probably benign
R3729:Dnah12 UTSW 14 26706065 missense probably benign 0.02
R3799:Dnah12 UTSW 14 26770923 missense probably damaging 1.00
R3846:Dnah12 UTSW 14 26710211 missense probably benign 0.00
R3892:Dnah12 UTSW 14 26856616 missense probably benign 0.03
R3921:Dnah12 UTSW 14 26771051 missense probably damaging 1.00
R3940:Dnah12 UTSW 14 26723599 missense probably benign
R4065:Dnah12 UTSW 14 26770448 missense probably benign 0.02
R4113:Dnah12 UTSW 14 26693567 missense probably damaging 0.98
R4259:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4260:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4348:Dnah12 UTSW 14 26814541 missense possibly damaging 0.94
R4457:Dnah12 UTSW 14 26815507 missense probably damaging 1.00
R4490:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4491:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4494:Dnah12 UTSW 14 26871855 missense probably damaging 0.99
R4523:Dnah12 UTSW 14 26770022 missense probably damaging 0.97
R4523:Dnah12 UTSW 14 26876958 missense possibly damaging 0.83
R4546:Dnah12 UTSW 14 26773014 missense probably damaging 1.00
R4584:Dnah12 UTSW 14 26772594 missense probably damaging 1.00
R4624:Dnah12 UTSW 14 26735758 missense possibly damaging 0.82
R4689:Dnah12 UTSW 14 26706839 missense probably benign 0.00
R4727:Dnah12 UTSW 14 26872317 missense probably damaging 1.00
R4732:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4733:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4851:Dnah12 UTSW 14 26716629 nonsense probably null
R4879:Dnah12 UTSW 14 26718046 critical splice donor site probably null
R4893:Dnah12 UTSW 14 26710170 missense possibly damaging 0.66
R4915:Dnah12 UTSW 14 26734570 missense probably damaging 1.00
R4927:Dnah12 UTSW 14 26861805 nonsense probably null
R4939:Dnah12 UTSW 14 26891524 missense probably damaging 1.00
R4962:Dnah12 UTSW 14 26716700 missense probably benign 0.00
R5011:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5013:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5043:Dnah12 UTSW 14 26884190 missense probably damaging 1.00
R5049:Dnah12 UTSW 14 26735697 missense probably benign 0.09
R5122:Dnah12 UTSW 14 26718000 missense probably benign 0.00
R5135:Dnah12 UTSW 14 26770477 missense probably damaging 0.99
R5149:Dnah12 UTSW 14 26850926 nonsense probably null
R5154:Dnah12 UTSW 14 26849363 missense probably benign 0.12
R5206:Dnah12 UTSW 14 26769985 missense probably damaging 1.00
R5307:Dnah12 UTSW 14 26693486 missense possibly damaging 0.49
R5330:Dnah12 UTSW 14 26773830 missense probably damaging 1.00
R5335:Dnah12 UTSW 14 26879738 missense probably damaging 1.00
R5339:Dnah12 UTSW 14 26814537 missense possibly damaging 0.83
R5354:Dnah12 UTSW 14 26774342 splice site probably null
R5389:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R5434:Dnah12 UTSW 14 26859299 missense probably damaging 1.00
R5466:Dnah12 UTSW 14 26771050 missense probably damaging 1.00
R5655:Dnah12 UTSW 14 26710269 missense probably benign 0.01
R5681:Dnah12 UTSW 14 26815495 missense probably benign 0.32
R5824:Dnah12 UTSW 14 26770518 critical splice donor site probably null
R5863:Dnah12 UTSW 14 26854921 missense probably damaging 1.00
R5890:Dnah12 UTSW 14 26706884 missense probably benign 0.09
R5912:Dnah12 UTSW 14 26770008 nonsense probably null
R5916:Dnah12 UTSW 14 26706918 missense possibly damaging 0.92
R5941:Dnah12 UTSW 14 26706867 missense probably benign 0.00
R5987:Dnah12 UTSW 14 26886871 missense possibly damaging 0.54
R5992:Dnah12 UTSW 14 26697341 missense probably benign 0.04
R6132:Dnah12 UTSW 14 26717911 missense probably damaging 1.00
R6136:Dnah12 UTSW 14 26875270 missense probably damaging 0.99
R6158:Dnah12 UTSW 14 26773685 missense possibly damaging 0.95
R6183:Dnah12 UTSW 14 26861769 missense probably damaging 1.00
R6191:Dnah12 UTSW 14 26710257 missense probably benign 0.03
R6235:Dnah12 UTSW 14 26854804 missense probably damaging 1.00
R6277:Dnah12 UTSW 14 26770482 missense probably damaging 1.00
R6332:Dnah12 UTSW 14 26717974 missense probably damaging 0.99
R6334:Dnah12 UTSW 14 26706834 missense possibly damaging 0.51
R6443:Dnah12 UTSW 14 26878051 missense probably benign 0.06
R6480:Dnah12 UTSW 14 26872455 missense probably damaging 1.00
R6530:Dnah12 UTSW 14 26735710 missense probably damaging 1.00
R6678:Dnah12 UTSW 14 26735692 missense probably damaging 1.00
R6709:Dnah12 UTSW 14 26872749 missense probably damaging 1.00
R6724:Dnah12 UTSW 14 26796223 missense probably benign 0.02
R6745:Dnah12 UTSW 14 26707228 missense probably damaging 0.99
R6788:Dnah12 UTSW 14 26801513 missense probably damaging 0.99
R6894:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R6912:Dnah12 UTSW 14 26878079 missense probably damaging 1.00
R6982:Dnah12 UTSW 14 26799076 intron probably null
R7001:Dnah12 UTSW 14 26879724 missense probably damaging 0.99
R7002:Dnah12 UTSW 14 26876998 missense probably damaging 1.00
R7017:Dnah12 UTSW 14 26735680 missense probably benign
R7107:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7108:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7121:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7122:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7135:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7135:Dnah12 UTSW 14 26801413 missense probably damaging 0.99
R7150:Dnah12 UTSW 14 26861732 missense probably damaging 0.99
R7188:Dnah12 UTSW 14 26814413 missense probably benign 0.04
R7201:Dnah12 UTSW 14 26814622 missense probably benign 0.08
R7202:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7204:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7204:Dnah12 UTSW 14 26781485 missense probably damaging 0.99
R7205:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7206:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7219:Dnah12 UTSW 14 26854880 missense probably damaging 0.99
R7337:Dnah12 UTSW 14 26766577 splice site probably null
R7339:Dnah12 UTSW 14 26872320 missense probably benign
R7363:Dnah12 UTSW 14 26724611 missense probably benign
R7426:Dnah12 UTSW 14 26724626 missense probably benign 0.01
R7472:Dnah12 UTSW 14 26856635 missense probably benign 0.01
R7579:Dnah12 UTSW 14 26770503 missense probably benign 0.05
R7655:Dnah12 UTSW 14 26859316 missense probably benign 0.21
R7656:Dnah12 UTSW 14 26859316 missense probably benign 0.21
R7694:Dnah12 UTSW 14 26781380 missense probably damaging 1.00
R7730:Dnah12 UTSW 14 26785933 missense probably damaging 1.00
V7580:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
V7581:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
X0018:Dnah12 UTSW 14 26814480 missense probably damaging 1.00
X0027:Dnah12 UTSW 14 26816288 missense probably damaging 1.00
X0065:Dnah12 UTSW 14 26814645 missense possibly damaging 0.93
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-06-12