Incidental Mutation 'R4249:Olfr109'
ID320548
Institutional Source Beutler Lab
Gene Symbol Olfr109
Ensembl Gene ENSMUSG00000029184
Gene Nameolfactory receptor 109
SynonymsGA_x6K02T2PSCP-1914078-1915022, MOR250-1
MMRRC Submission 041065-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4249 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37458916-37471590 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37466824 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 206 (M206T)
Ref Sequence ENSEMBL: ENSMUSP00000150044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031086] [ENSMUST00000214668] [ENSMUST00000214938] [ENSMUST00000217602]
Predicted Effect probably damaging
Transcript: ENSMUST00000031086
AA Change: M206T

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031086
Gene: ENSMUSG00000029184
AA Change: M206T

DomainStartEndE-ValueType
Pfam:7tm_4 29 309 3.4e-54 PFAM
Pfam:7tm_1 39 291 6.3e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214668
AA Change: M206T

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000214938
AA Change: M206T

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000217602
AA Change: M206T

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
Ankrd39 A G 1: 36,547,155 S11P probably benign Het
Aox2 A G 1: 58,299,819 S324G probably benign Het
Atl3 T C 19: 7,532,338 V477A probably benign Het
Bcar1 T C 8: 111,720,893 T151A probably benign Het
Cdc42bpg A G 19: 6,315,266 T718A possibly damaging Het
Col9a1 C T 1: 24,244,381 R843C probably damaging Het
Dnah12 T A 14: 26,709,186 D316E possibly damaging Het
Fat2 A G 11: 55,284,301 V1862A probably damaging Het
Fbxw5 C A 2: 25,503,460 N233K probably damaging Het
Fcer2a A G 8: 3,688,831 F75L probably benign Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Gimd1 T C 3: 132,644,408 V144A possibly damaging Het
Glt1d1 T C 5: 127,691,112 probably null Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Kansl1l C T 1: 66,773,478 D459N probably damaging Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Muc4 T C 16: 32,755,826 probably benign Het
Myom1 T A 17: 71,092,140 V999E probably damaging Het
Nckap5 A G 1: 126,027,639 L460P probably benign Het
Phf13 A T 4: 151,992,095 N213K probably damaging Het
Phldb3 T C 7: 24,627,320 I591T probably damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Plekhh2 A G 17: 84,586,337 E860G possibly damaging Het
Rest A G 5: 77,282,112 T793A probably benign Het
Ropn1 C T 16: 34,678,456 Q205* probably null Het
Sacs A C 14: 61,203,457 K984T probably benign Het
Samd11 G A 4: 156,250,486 R102C probably damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Shank1 C A 7: 44,319,736 H352N unknown Het
Slc22a27 A T 19: 7,925,879 I162K possibly damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Tln1 A T 4: 43,536,104 V2027E probably damaging Het
Trdn A G 10: 33,450,998 I594M probably benign Het
Trim5 C G 7: 104,276,815 E180Q possibly damaging Het
Tsen2 A G 6: 115,547,824 probably benign Het
Tubb1 A T 2: 174,455,733 E45V probably null Het
Vmn2r67 T A 7: 85,150,514 probably null Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 121,604,292 probably benign Het
Zfp160 T A 17: 21,025,738 F183L probably benign Het
Other mutations in Olfr109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01813:Olfr109 APN 17 37466758 missense probably damaging 1.00
IGL02039:Olfr109 APN 17 37466449 missense possibly damaging 0.49
IGL02391:Olfr109 APN 17 37466586 missense probably damaging 1.00
IGL02730:Olfr109 APN 17 37466859 missense probably damaging 1.00
IGL02751:Olfr109 APN 17 37466415 missense probably damaging 0.98
IGL02891:Olfr109 APN 17 37466944 missense probably damaging 1.00
IGL03023:Olfr109 APN 17 37466994 missense probably benign
IGL03343:Olfr109 APN 17 37466409 missense probably damaging 1.00
R0026:Olfr109 UTSW 17 37466803 missense probably damaging 0.99
R0579:Olfr109 UTSW 17 37466347 missense probably benign 0.01
R1751:Olfr109 UTSW 17 37466901 missense probably benign 0.00
R1848:Olfr109 UTSW 17 37467047 missense probably damaging 0.99
R2392:Olfr109 UTSW 17 37466419 missense probably damaging 1.00
R4464:Olfr109 UTSW 17 37466851 missense probably damaging 1.00
R4857:Olfr109 UTSW 17 37466823 missense possibly damaging 0.80
R4947:Olfr109 UTSW 17 37466743 missense probably damaging 1.00
R5107:Olfr109 UTSW 17 37466253 missense probably damaging 0.97
R5526:Olfr109 UTSW 17 37467112 missense unknown
R6147:Olfr109 UTSW 17 37466539 missense probably benign 0.00
R6416:Olfr109 UTSW 17 37467080 nonsense probably null
R7450:Olfr109 UTSW 17 37466616 missense probably benign 0.00
R7487:Olfr109 UTSW 17 37466566 missense probably damaging 0.96
R7822:Olfr109 UTSW 17 37467103 missense probably benign 0.00
R8041:Olfr109 UTSW 17 37466649 missense probably benign
R8051:Olfr109 UTSW 17 37466322 missense probably damaging 1.00
X0063:Olfr109 UTSW 17 37466524 missense probably damaging 1.00
X0065:Olfr109 UTSW 17 37466318 missense probably damaging 1.00
Z1176:Olfr109 UTSW 17 37466661 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CAGTTGTGCATCCTGTTGGC -3'
(R):5'- TCACTCATGGAGGAGGCTGATG -3'

Sequencing Primer
(F):5'- TGCTACGGCCTGGTTCACAAG -3'
(R):5'- AGGAGGCTGATGCTGTGGC -3'
Posted On2015-06-12