Incidental Mutation 'R4249:Plekhh2'
ID 320550
Institutional Source Beutler Lab
Gene Symbol Plekhh2
Ensembl Gene ENSMUSG00000040852
Gene Name pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Synonyms
MMRRC Submission 041065-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R4249 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 84819323-84929566 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84893765 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 860 (E860G)
Ref Sequence ENSEMBL: ENSMUSP00000039628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047206]
AlphaFold Q8C115
Predicted Effect possibly damaging
Transcript: ENSMUST00000047206
AA Change: E860G

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039628
Gene: ENSMUSG00000040852
AA Change: E860G

DomainStartEndE-ValueType
coiled coil region 19 84 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
coiled coil region 137 174 N/A INTRINSIC
low complexity region 427 442 N/A INTRINSIC
low complexity region 579 593 N/A INTRINSIC
low complexity region 612 651 N/A INTRINSIC
low complexity region 657 666 N/A INTRINSIC
PH 703 798 4.7e-19 SMART
PH 811 920 1.15e-4 SMART
MyTH4 954 1109 8.49e-39 SMART
B41 1116 1353 1.01e-27 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,606,013 (GRCm39) N36S possibly damaging Het
Ankrd39 A G 1: 36,586,236 (GRCm39) S11P probably benign Het
Aox1 A G 1: 58,338,978 (GRCm39) S324G probably benign Het
Atl3 T C 19: 7,509,703 (GRCm39) V477A probably benign Het
Bcar1 T C 8: 112,447,525 (GRCm39) T151A probably benign Het
Cdc42bpg A G 19: 6,365,296 (GRCm39) T718A possibly damaging Het
Col9a1 C T 1: 24,283,462 (GRCm39) R843C probably damaging Het
Dnah12 T A 14: 26,430,341 (GRCm39) D316E possibly damaging Het
Fat2 A G 11: 55,175,127 (GRCm39) V1862A probably damaging Het
Fbxw5 C A 2: 25,393,472 (GRCm39) N233K probably damaging Het
Fcer2a A G 8: 3,738,831 (GRCm39) F75L probably benign Het
Fhod3 A G 18: 25,123,123 (GRCm39) K271R probably null Het
Gimd1 T C 3: 132,350,169 (GRCm39) V144A possibly damaging Het
Glt1d1 T C 5: 127,768,176 (GRCm39) probably null Het
Hecw2 C T 1: 53,871,804 (GRCm39) V1381M probably damaging Het
Kansl1l C T 1: 66,812,637 (GRCm39) D459N probably damaging Het
Lmtk3 G A 7: 45,443,486 (GRCm39) C723Y possibly damaging Het
Muc4 T C 16: 32,576,200 (GRCm39) probably benign Het
Myom1 T A 17: 71,399,135 (GRCm39) V999E probably damaging Het
Nckap5 A G 1: 125,955,376 (GRCm39) L460P probably benign Het
Or12d17 T C 17: 37,777,715 (GRCm39) M206T probably damaging Het
Phf13 A T 4: 152,076,552 (GRCm39) N213K probably damaging Het
Phldb3 T C 7: 24,326,745 (GRCm39) I591T probably damaging Het
Pik3cb T C 9: 98,983,229 (GRCm39) probably null Het
Pkd1l1 C T 11: 8,815,543 (GRCm39) R1456K possibly damaging Het
Resf1 T A 6: 149,227,041 (GRCm39) M29K possibly damaging Het
Rest A G 5: 77,429,959 (GRCm39) T793A probably benign Het
Ropn1 C T 16: 34,498,826 (GRCm39) Q205* probably null Het
Sacs A C 14: 61,440,906 (GRCm39) K984T probably benign Het
Samd11 G A 4: 156,334,943 (GRCm39) R102C probably damaging Het
Satl1 A G X: 111,316,033 (GRCm39) S141P probably benign Het
Shank1 C A 7: 43,969,160 (GRCm39) H352N unknown Het
Slc22a27 A T 19: 7,903,244 (GRCm39) I162K possibly damaging Het
Snx8 A G 5: 140,341,800 (GRCm39) L121P probably damaging Het
Sumf1 A C 6: 108,131,974 (GRCm39) V156G probably damaging Het
Tln1 A T 4: 43,536,104 (GRCm39) V2027E probably damaging Het
Trdn A G 10: 33,326,994 (GRCm39) I594M probably benign Het
Trim5 C G 7: 103,926,022 (GRCm39) E180Q possibly damaging Het
Tsen2 A G 6: 115,524,785 (GRCm39) probably benign Het
Tubb1 A T 2: 174,297,526 (GRCm39) E45V probably null Het
Vmn2r67 T A 7: 84,799,722 (GRCm39) probably null Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 122,331,031 (GRCm39) probably benign Het
Zfp160 T A 17: 21,246,000 (GRCm39) F183L probably benign Het
Other mutations in Plekhh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Plekhh2 APN 17 84,829,203 (GRCm39) missense probably benign 0.00
IGL00514:Plekhh2 APN 17 84,903,734 (GRCm39) critical splice donor site probably null
IGL00773:Plekhh2 APN 17 84,914,296 (GRCm39) missense probably benign 0.01
IGL00985:Plekhh2 APN 17 84,871,356 (GRCm39) missense probably benign 0.00
IGL01116:Plekhh2 APN 17 84,914,356 (GRCm39) missense possibly damaging 0.94
IGL01394:Plekhh2 APN 17 84,864,858 (GRCm39) missense probably benign 0.24
IGL01419:Plekhh2 APN 17 84,890,980 (GRCm39) splice site probably benign
IGL01932:Plekhh2 APN 17 84,884,689 (GRCm39) missense probably benign 0.00
IGL02097:Plekhh2 APN 17 84,906,608 (GRCm39) missense possibly damaging 0.69
IGL02157:Plekhh2 APN 17 84,874,370 (GRCm39) splice site probably benign
IGL02163:Plekhh2 APN 17 84,898,223 (GRCm39) missense probably benign 0.45
IGL02237:Plekhh2 APN 17 84,883,213 (GRCm39) missense probably benign 0.00
IGL02322:Plekhh2 APN 17 84,896,894 (GRCm39) nonsense probably null
IGL02422:Plekhh2 APN 17 84,871,237 (GRCm39) splice site probably benign
IGL02483:Plekhh2 APN 17 84,903,688 (GRCm39) missense possibly damaging 0.81
IGL02493:Plekhh2 APN 17 84,914,391 (GRCm39) critical splice donor site probably null
IGL03007:Plekhh2 APN 17 84,882,388 (GRCm39) missense possibly damaging 0.65
R0003:Plekhh2 UTSW 17 84,864,820 (GRCm39) missense probably damaging 1.00
R0005:Plekhh2 UTSW 17 84,893,861 (GRCm39) missense probably benign 0.16
R0099:Plekhh2 UTSW 17 84,899,100 (GRCm39) nonsense probably null
R0331:Plekhh2 UTSW 17 84,893,794 (GRCm39) missense possibly damaging 0.81
R0883:Plekhh2 UTSW 17 84,925,459 (GRCm39) missense probably benign 0.11
R1051:Plekhh2 UTSW 17 84,829,255 (GRCm39) critical splice donor site probably null
R1084:Plekhh2 UTSW 17 84,878,554 (GRCm39) missense probably damaging 0.99
R1351:Plekhh2 UTSW 17 84,884,574 (GRCm39) splice site probably benign
R1459:Plekhh2 UTSW 17 84,918,203 (GRCm39) nonsense probably null
R1469:Plekhh2 UTSW 17 84,883,199 (GRCm39) missense probably benign 0.03
R1469:Plekhh2 UTSW 17 84,883,199 (GRCm39) missense probably benign 0.03
R1510:Plekhh2 UTSW 17 84,867,004 (GRCm39) splice site probably null
R1699:Plekhh2 UTSW 17 84,884,612 (GRCm39) nonsense probably null
R1738:Plekhh2 UTSW 17 84,874,125 (GRCm39) missense possibly damaging 0.67
R1773:Plekhh2 UTSW 17 84,906,693 (GRCm39) missense probably damaging 1.00
R1796:Plekhh2 UTSW 17 84,906,561 (GRCm39) critical splice acceptor site probably null
R1823:Plekhh2 UTSW 17 84,882,617 (GRCm39) missense probably damaging 1.00
R1998:Plekhh2 UTSW 17 84,914,305 (GRCm39) missense possibly damaging 0.58
R2437:Plekhh2 UTSW 17 84,893,907 (GRCm39) splice site probably null
R2847:Plekhh2 UTSW 17 84,905,394 (GRCm39) missense probably damaging 1.00
R4088:Plekhh2 UTSW 17 84,925,427 (GRCm39) missense probably benign 0.10
R4227:Plekhh2 UTSW 17 84,874,223 (GRCm39) missense probably benign 0.00
R4347:Plekhh2 UTSW 17 84,927,130 (GRCm39) missense probably benign 0.12
R4562:Plekhh2 UTSW 17 84,873,525 (GRCm39) missense probably benign 0.00
R4649:Plekhh2 UTSW 17 84,882,691 (GRCm39) missense probably damaging 1.00
R4737:Plekhh2 UTSW 17 84,871,387 (GRCm39) missense probably benign
R4743:Plekhh2 UTSW 17 84,878,548 (GRCm39) missense probably damaging 1.00
R4858:Plekhh2 UTSW 17 84,908,125 (GRCm39) missense probably damaging 1.00
R5036:Plekhh2 UTSW 17 84,879,189 (GRCm39) missense probably damaging 0.99
R5260:Plekhh2 UTSW 17 84,884,593 (GRCm39) missense probably damaging 0.99
R5385:Plekhh2 UTSW 17 84,864,894 (GRCm39) missense probably benign 0.00
R5409:Plekhh2 UTSW 17 84,893,906 (GRCm39) critical splice donor site probably null
R5510:Plekhh2 UTSW 17 84,874,275 (GRCm39) missense probably benign
R5557:Plekhh2 UTSW 17 84,867,580 (GRCm39) missense probably benign 0.10
R5684:Plekhh2 UTSW 17 84,905,346 (GRCm39) missense probably damaging 1.00
R5685:Plekhh2 UTSW 17 84,877,310 (GRCm39) missense probably damaging 1.00
R5724:Plekhh2 UTSW 17 84,874,233 (GRCm39) missense probably benign 0.00
R5742:Plekhh2 UTSW 17 84,905,408 (GRCm39) missense probably damaging 1.00
R5817:Plekhh2 UTSW 17 84,879,154 (GRCm39) missense possibly damaging 0.86
R6218:Plekhh2 UTSW 17 84,898,992 (GRCm39) missense probably benign 0.03
R6334:Plekhh2 UTSW 17 84,874,294 (GRCm39) missense probably benign
R6345:Plekhh2 UTSW 17 84,883,215 (GRCm39) missense probably benign 0.01
R6617:Plekhh2 UTSW 17 84,873,715 (GRCm39) missense possibly damaging 0.65
R6755:Plekhh2 UTSW 17 84,899,013 (GRCm39) missense probably damaging 1.00
R6864:Plekhh2 UTSW 17 84,925,427 (GRCm39) missense probably benign 0.10
R7171:Plekhh2 UTSW 17 84,829,216 (GRCm39) missense probably damaging 0.96
R7413:Plekhh2 UTSW 17 84,873,724 (GRCm39) missense probably benign 0.03
R7585:Plekhh2 UTSW 17 84,884,608 (GRCm39) missense probably benign 0.11
R7640:Plekhh2 UTSW 17 84,918,204 (GRCm39) missense possibly damaging 0.50
R7733:Plekhh2 UTSW 17 84,890,952 (GRCm39) nonsense probably null
R7877:Plekhh2 UTSW 17 84,882,434 (GRCm39) missense probably benign
R8085:Plekhh2 UTSW 17 84,905,384 (GRCm39) missense probably damaging 0.98
R8206:Plekhh2 UTSW 17 84,898,277 (GRCm39) missense possibly damaging 0.47
R8296:Plekhh2 UTSW 17 84,908,113 (GRCm39) missense probably damaging 0.98
R8344:Plekhh2 UTSW 17 84,879,189 (GRCm39) missense possibly damaging 0.64
R8438:Plekhh2 UTSW 17 84,877,379 (GRCm39) missense probably benign
R8487:Plekhh2 UTSW 17 84,864,909 (GRCm39) missense possibly damaging 0.55
R8708:Plekhh2 UTSW 17 84,882,421 (GRCm39) missense probably benign 0.00
R8830:Plekhh2 UTSW 17 84,829,231 (GRCm39) missense probably damaging 1.00
R8847:Plekhh2 UTSW 17 84,878,479 (GRCm39) missense probably benign 0.00
R8918:Plekhh2 UTSW 17 84,906,621 (GRCm39) missense possibly damaging 0.80
R9047:Plekhh2 UTSW 17 84,898,190 (GRCm39) missense probably damaging 0.99
R9404:Plekhh2 UTSW 17 84,878,468 (GRCm39) critical splice acceptor site probably null
R9428:Plekhh2 UTSW 17 84,873,841 (GRCm39) missense probably benign
R9516:Plekhh2 UTSW 17 84,918,240 (GRCm39) missense probably benign 0.00
R9559:Plekhh2 UTSW 17 84,899,017 (GRCm39) missense probably damaging 1.00
R9589:Plekhh2 UTSW 17 84,854,918 (GRCm39) missense possibly damaging 0.90
R9641:Plekhh2 UTSW 17 84,874,130 (GRCm39) missense probably damaging 1.00
R9659:Plekhh2 UTSW 17 84,854,892 (GRCm39) missense possibly damaging 0.95
R9788:Plekhh2 UTSW 17 84,854,892 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATCACAGTTAGGGTTTCTGCC -3'
(R):5'- ACGTCTGAGTCACTTTAGAAGAAC -3'

Sequencing Primer
(F):5'- GTTGTGACAACATGGCCATG -3'
(R):5'- AGAACTGGGAGATGTTAGGTACCTTC -3'
Posted On 2015-06-12