Incidental Mutation 'R4249:Cdc42bpg'
ID320553
Institutional Source Beutler Lab
Gene Symbol Cdc42bpg
Ensembl Gene ENSMUSG00000024769
Gene NameCDC42 binding protein kinase gamma (DMPK-like)
SynonymsMRCKgamma
MMRRC Submission 041065-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.344) question?
Stock #R4249 (G1)
Quality Score118
Status Not validated
Chromosome19
Chromosomal Location6306456-6325652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6315266 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 718 (T718A)
Ref Sequence ENSEMBL: ENSMUSP00000025681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025681]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025681
AA Change: T718A

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000025681
Gene: ENSMUSG00000024769
AA Change: T718A

DomainStartEndE-ValueType
low complexity region 21 31 N/A INTRINSIC
S_TKc 71 337 1.63e-87 SMART
S_TK_X 338 400 7.85e-12 SMART
coiled coil region 444 551 N/A INTRINSIC
coiled coil region 630 675 N/A INTRINSIC
Pfam:DMPK_coil 743 801 4.6e-21 PFAM
low complexity region 861 873 N/A INTRINSIC
C1 878 926 1.78e-7 SMART
PH 947 1067 3.57e-10 SMART
Pfam:CNH 1096 1362 7.5e-56 PFAM
low complexity region 1401 1412 N/A INTRINSIC
low complexity region 1535 1551 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
Ankrd39 A G 1: 36,547,155 S11P probably benign Het
Aox2 A G 1: 58,299,819 S324G probably benign Het
Atl3 T C 19: 7,532,338 V477A probably benign Het
Bcar1 T C 8: 111,720,893 T151A probably benign Het
Col9a1 C T 1: 24,244,381 R843C probably damaging Het
Dnah12 T A 14: 26,709,186 D316E possibly damaging Het
Fat2 A G 11: 55,284,301 V1862A probably damaging Het
Fbxw5 C A 2: 25,503,460 N233K probably damaging Het
Fcer2a A G 8: 3,688,831 F75L probably benign Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Gimd1 T C 3: 132,644,408 V144A possibly damaging Het
Glt1d1 T C 5: 127,691,112 probably null Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Kansl1l C T 1: 66,773,478 D459N probably damaging Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Muc4 T C 16: 32,755,826 probably benign Het
Myom1 T A 17: 71,092,140 V999E probably damaging Het
Nckap5 A G 1: 126,027,639 L460P probably benign Het
Olfr109 T C 17: 37,466,824 M206T probably damaging Het
Phf13 A T 4: 151,992,095 N213K probably damaging Het
Phldb3 T C 7: 24,627,320 I591T probably damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Plekhh2 A G 17: 84,586,337 E860G possibly damaging Het
Rest A G 5: 77,282,112 T793A probably benign Het
Ropn1 C T 16: 34,678,456 Q205* probably null Het
Sacs A C 14: 61,203,457 K984T probably benign Het
Samd11 G A 4: 156,250,486 R102C probably damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Shank1 C A 7: 44,319,736 H352N unknown Het
Slc22a27 A T 19: 7,925,879 I162K possibly damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Tln1 A T 4: 43,536,104 V2027E probably damaging Het
Trdn A G 10: 33,450,998 I594M probably benign Het
Trim5 C G 7: 104,276,815 E180Q possibly damaging Het
Tsen2 A G 6: 115,547,824 probably benign Het
Tubb1 A T 2: 174,455,733 E45V probably null Het
Vmn2r67 T A 7: 85,150,514 probably null Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 121,604,292 probably benign Het
Zfp160 T A 17: 21,025,738 F183L probably benign Het
Other mutations in Cdc42bpg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Cdc42bpg APN 19 6312205 splice site probably benign
IGL01415:Cdc42bpg APN 19 6310851 missense probably damaging 1.00
IGL01517:Cdc42bpg APN 19 6318437 missense probably damaging 1.00
IGL01585:Cdc42bpg APN 19 6320432 missense possibly damaging 0.93
IGL01743:Cdc42bpg APN 19 6309823 critical splice donor site probably null
IGL01930:Cdc42bpg APN 19 6311368 missense probably damaging 1.00
IGL02092:Cdc42bpg APN 19 6316826 splice site probably benign
IGL02355:Cdc42bpg APN 19 6310809 missense possibly damaging 0.93
IGL02362:Cdc42bpg APN 19 6310809 missense possibly damaging 0.93
IGL02498:Cdc42bpg APN 19 6322793 missense probably benign
IGL03004:Cdc42bpg APN 19 6311383 missense probably benign 0.38
IGL03037:Cdc42bpg APN 19 6311200 missense probably damaging 1.00
PIT1430001:Cdc42bpg UTSW 19 6322552 splice site probably null
R0304:Cdc42bpg UTSW 19 6317248 missense probably damaging 0.99
R0367:Cdc42bpg UTSW 19 6311395 missense probably damaging 1.00
R0412:Cdc42bpg UTSW 19 6313457 missense probably damaging 1.00
R0742:Cdc42bpg UTSW 19 6318575 critical splice donor site probably null
R1026:Cdc42bpg UTSW 19 6317187 missense probably damaging 1.00
R1056:Cdc42bpg UTSW 19 6314021 missense probably benign 0.10
R1065:Cdc42bpg UTSW 19 6322826 missense probably damaging 1.00
R1476:Cdc42bpg UTSW 19 6313782 missense probably damaging 0.99
R1854:Cdc42bpg UTSW 19 6320807 missense possibly damaging 0.67
R1936:Cdc42bpg UTSW 19 6310309 missense probably damaging 1.00
R1962:Cdc42bpg UTSW 19 6306855 missense probably damaging 1.00
R2070:Cdc42bpg UTSW 19 6320488 missense probably damaging 1.00
R2167:Cdc42bpg UTSW 19 6317677 missense probably damaging 1.00
R3826:Cdc42bpg UTSW 19 6317645 missense probably damaging 0.99
R3829:Cdc42bpg UTSW 19 6317645 missense probably damaging 0.99
R4190:Cdc42bpg UTSW 19 6321681 missense probably damaging 1.00
R4499:Cdc42bpg UTSW 19 6320555 missense possibly damaging 0.69
R4731:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4732:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4733:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4797:Cdc42bpg UTSW 19 6320447 missense probably damaging 1.00
R4831:Cdc42bpg UTSW 19 6311335 missense probably damaging 0.97
R4984:Cdc42bpg UTSW 19 6316223 missense possibly damaging 0.88
R5092:Cdc42bpg UTSW 19 6313220 missense probably benign 0.01
R5135:Cdc42bpg UTSW 19 6320618 missense probably damaging 1.00
R5183:Cdc42bpg UTSW 19 6321805 intron probably benign
R5208:Cdc42bpg UTSW 19 6321720 missense probably benign 0.01
R5240:Cdc42bpg UTSW 19 6315899 missense probably damaging 1.00
R5475:Cdc42bpg UTSW 19 6311071 missense probably damaging 0.99
R5703:Cdc42bpg UTSW 19 6322673 missense possibly damaging 0.87
R5876:Cdc42bpg UTSW 19 6310815 missense probably damaging 1.00
R6024:Cdc42bpg UTSW 19 6317496 missense probably damaging 1.00
R6266:Cdc42bpg UTSW 19 6311473 missense probably damaging 1.00
R6450:Cdc42bpg UTSW 19 6314488 splice site probably null
R6493:Cdc42bpg UTSW 19 6318455 missense probably damaging 0.96
R6983:Cdc42bpg UTSW 19 6321668 missense probably damaging 1.00
R7080:Cdc42bpg UTSW 19 6315189 missense probably damaging 0.97
R7125:Cdc42bpg UTSW 19 6322291 missense probably damaging 1.00
R7183:Cdc42bpg UTSW 19 6310797 missense probably damaging 1.00
R7317:Cdc42bpg UTSW 19 6314504 missense probably benign 0.11
R7426:Cdc42bpg UTSW 19 6318398 missense probably damaging 1.00
R7504:Cdc42bpg UTSW 19 6306784 missense possibly damaging 0.85
R7530:Cdc42bpg UTSW 19 6322275 missense probably benign 0.21
R7530:Cdc42bpg UTSW 19 6322276 missense probably benign 0.12
R7739:Cdc42bpg UTSW 19 6310815 missense probably damaging 1.00
R7903:Cdc42bpg UTSW 19 6313469 missense possibly damaging 0.94
R8186:Cdc42bpg UTSW 19 6306865 missense probably damaging 1.00
R8331:Cdc42bpg UTSW 19 6313447 missense probably benign 0.08
Z1177:Cdc42bpg UTSW 19 6309746 missense probably damaging 1.00
Z1177:Cdc42bpg UTSW 19 6314522 missense possibly damaging 0.94
Z1177:Cdc42bpg UTSW 19 6314523 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCTCAGCTGGTAGGGACATG -3'
(R):5'- TCAGCATAAACCTGGAGCCTTG -3'

Sequencing Primer
(F):5'- CTGGTAGGGACATGGAGCCTG -3'
(R):5'- AGGTATGCTGCCAAACCTG -3'
Posted On2015-06-12