Incidental Mutation 'R4249:Atl3'
ID320554
Institutional Source Beutler Lab
Gene Symbol Atl3
Ensembl Gene ENSMUSG00000024759
Gene Nameatlastin GTPase 3
Synonyms
MMRRC Submission 041065-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4249 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location7494040-7538608 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7532338 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 477 (V477A)
Ref Sequence ENSEMBL: ENSMUSP00000025668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025668] [ENSMUST00000170373]
Predicted Effect probably benign
Transcript: ENSMUST00000025668
AA Change: V477A

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000025668
Gene: ENSMUSG00000024759
AA Change: V477A

DomainStartEndE-ValueType
Pfam:GBP 36 310 7.2e-99 PFAM
Pfam:GBP_C 312 438 1.7e-9 PFAM
transmembrane domain 444 466 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170373
AA Change: V472A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000132619
Gene: ENSMUSG00000024759
AA Change: V472A

DomainStartEndE-ValueType
Pfam:GBP 31 305 9.1e-98 PFAM
Pfam:GBP_C 307 433 7.4e-10 PFAM
transmembrane domain 439 461 N/A INTRINSIC
transmembrane domain 463 485 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of dynamin-like, integral membrane GTPases. The encoded protein is required for the proper formation of the network of interconnected tubules of the endoplasmic reticulum. Mutations in this gene may be associated with hereditary sensory neuropathy type IF. Alternatively spliced transcript variants that encode distinct isoforms have been described. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
Ankrd39 A G 1: 36,547,155 S11P probably benign Het
Aox2 A G 1: 58,299,819 S324G probably benign Het
Bcar1 T C 8: 111,720,893 T151A probably benign Het
Cdc42bpg A G 19: 6,315,266 T718A possibly damaging Het
Col9a1 C T 1: 24,244,381 R843C probably damaging Het
Dnah12 T A 14: 26,709,186 D316E possibly damaging Het
Fat2 A G 11: 55,284,301 V1862A probably damaging Het
Fbxw5 C A 2: 25,503,460 N233K probably damaging Het
Fcer2a A G 8: 3,688,831 F75L probably benign Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Gimd1 T C 3: 132,644,408 V144A possibly damaging Het
Glt1d1 T C 5: 127,691,112 probably null Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Kansl1l C T 1: 66,773,478 D459N probably damaging Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Muc4 T C 16: 32,755,826 probably benign Het
Myom1 T A 17: 71,092,140 V999E probably damaging Het
Nckap5 A G 1: 126,027,639 L460P probably benign Het
Olfr109 T C 17: 37,466,824 M206T probably damaging Het
Phf13 A T 4: 151,992,095 N213K probably damaging Het
Phldb3 T C 7: 24,627,320 I591T probably damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Plekhh2 A G 17: 84,586,337 E860G possibly damaging Het
Rest A G 5: 77,282,112 T793A probably benign Het
Ropn1 C T 16: 34,678,456 Q205* probably null Het
Sacs A C 14: 61,203,457 K984T probably benign Het
Samd11 G A 4: 156,250,486 R102C probably damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Shank1 C A 7: 44,319,736 H352N unknown Het
Slc22a27 A T 19: 7,925,879 I162K possibly damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Tln1 A T 4: 43,536,104 V2027E probably damaging Het
Trdn A G 10: 33,450,998 I594M probably benign Het
Trim5 C G 7: 104,276,815 E180Q possibly damaging Het
Tsen2 A G 6: 115,547,824 probably benign Het
Tubb1 A T 2: 174,455,733 E45V probably null Het
Vmn2r67 T A 7: 85,150,514 probably null Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 121,604,292 probably benign Het
Zfp160 T A 17: 21,025,738 F183L probably benign Het
Other mutations in Atl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02667:Atl3 APN 19 7509416 missense possibly damaging 0.72
R0042:Atl3 UTSW 19 7529023 missense probably damaging 1.00
R0607:Atl3 UTSW 19 7529666 critical splice donor site probably null
R0975:Atl3 UTSW 19 7521135 nonsense probably null
R1582:Atl3 UTSW 19 7516899 missense probably damaging 1.00
R4195:Atl3 UTSW 19 7518546 missense possibly damaging 0.59
R4505:Atl3 UTSW 19 7520819 missense probably benign 0.00
R4836:Atl3 UTSW 19 7509545 nonsense probably null
R5649:Atl3 UTSW 19 7532227 missense possibly damaging 0.50
R5721:Atl3 UTSW 19 7529011 missense probably benign 0.00
R6459:Atl3 UTSW 19 7520798 missense probably benign 0.07
R6530:Atl3 UTSW 19 7522134 missense probably benign
R6543:Atl3 UTSW 19 7510098 missense probably damaging 1.00
R6550:Atl3 UTSW 19 7522138 missense probably benign
R7059:Atl3 UTSW 19 7533968 missense probably benign
R7059:Atl3 UTSW 19 7533969 missense probably benign 0.08
R7220:Atl3 UTSW 19 7529068 missense probably null 0.02
R7666:Atl3 UTSW 19 7510040 missense probably benign 0.19
X0020:Atl3 UTSW 19 7530569 missense probably benign 0.00
Z1176:Atl3 UTSW 19 7510037 missense probably damaging 1.00
Z1177:Atl3 UTSW 19 7530553 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TTCAGCTTCCGTTACCAGCAG -3'
(R):5'- CCATCACAAAGTGGGCTCAC -3'

Sequencing Primer
(F):5'- CTGGAGGAGGAAATCAAAGAACTG -3'
(R):5'- TCAAATCTTACTTCAGAAGCACATC -3'
Posted On2015-06-12