Incidental Mutation 'R4249:Satl1'
ID320556
Institutional Source Beutler Lab
Gene Symbol Satl1
Ensembl Gene ENSMUSG00000025527
Gene Namespermidine/spermine N1-acetyl transferase-like 1
Synonyms4930404K22Rik
MMRRC Submission 041065-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R4249 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location112384303-112406779 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112406336 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 141 (S141P)
Ref Sequence ENSEMBL: ENSMUSP00000026601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026601]
Predicted Effect probably benign
Transcript: ENSMUST00000026601
AA Change: S141P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026601
Gene: ENSMUSG00000025527
AA Change: S141P

DomainStartEndE-ValueType
internal_repeat_2 13 201 4.46e-7 PROSPERO
internal_repeat_1 30 255 8.83e-12 PROSPERO
low complexity region 260 271 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
internal_repeat_1 333 584 8.83e-12 PROSPERO
internal_repeat_2 399 595 4.46e-7 PROSPERO
Pfam:Acetyltransf_1 638 718 2.4e-10 PFAM
low complexity region 734 744 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124335
SMART Domains Protein: ENSMUSP00000122770
Gene: ENSMUSG00000025527

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
Pfam:Acetyltransf_1 327 407 1.5e-9 PFAM
low complexity region 423 433 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
Ankrd39 A G 1: 36,547,155 S11P probably benign Het
Aox2 A G 1: 58,299,819 S324G probably benign Het
Atl3 T C 19: 7,532,338 V477A probably benign Het
Bcar1 T C 8: 111,720,893 T151A probably benign Het
Cdc42bpg A G 19: 6,315,266 T718A possibly damaging Het
Col9a1 C T 1: 24,244,381 R843C probably damaging Het
Dnah12 T A 14: 26,709,186 D316E possibly damaging Het
Fat2 A G 11: 55,284,301 V1862A probably damaging Het
Fbxw5 C A 2: 25,503,460 N233K probably damaging Het
Fcer2a A G 8: 3,688,831 F75L probably benign Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Gimd1 T C 3: 132,644,408 V144A possibly damaging Het
Glt1d1 T C 5: 127,691,112 probably null Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Kansl1l C T 1: 66,773,478 D459N probably damaging Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Muc4 T C 16: 32,755,826 probably benign Het
Myom1 T A 17: 71,092,140 V999E probably damaging Het
Nckap5 A G 1: 126,027,639 L460P probably benign Het
Olfr109 T C 17: 37,466,824 M206T probably damaging Het
Phf13 A T 4: 151,992,095 N213K probably damaging Het
Phldb3 T C 7: 24,627,320 I591T probably damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Plekhh2 A G 17: 84,586,337 E860G possibly damaging Het
Rest A G 5: 77,282,112 T793A probably benign Het
Ropn1 C T 16: 34,678,456 Q205* probably null Het
Sacs A C 14: 61,203,457 K984T probably benign Het
Samd11 G A 4: 156,250,486 R102C probably damaging Het
Shank1 C A 7: 44,319,736 H352N unknown Het
Slc22a27 A T 19: 7,925,879 I162K possibly damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Tln1 A T 4: 43,536,104 V2027E probably damaging Het
Trdn A G 10: 33,450,998 I594M probably benign Het
Trim5 C G 7: 104,276,815 E180Q possibly damaging Het
Tsen2 A G 6: 115,547,824 probably benign Het
Tubb1 A T 2: 174,455,733 E45V probably null Het
Vmn2r67 T A 7: 85,150,514 probably null Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 121,604,292 probably benign Het
Zfp160 T A 17: 21,025,738 F183L probably benign Het
Other mutations in Satl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Satl1 APN X 112405769 missense possibly damaging 0.95
R4246:Satl1 UTSW X 112406336 missense probably benign
R4247:Satl1 UTSW X 112406336 missense probably benign
R4248:Satl1 UTSW X 112406336 missense probably benign
R4250:Satl1 UTSW X 112406336 missense probably benign
R6067:Satl1 UTSW X 112405916 missense probably benign
R6079:Satl1 UTSW X 112405916 missense probably benign
R6138:Satl1 UTSW X 112405916 missense probably benign
U15987:Satl1 UTSW X 112405916 missense probably benign
Z1176:Satl1 UTSW X 112404992 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TCTCACACTTGGAGGGCTTG -3'
(R):5'- TATAAATCAAGCAGGCCAGAGC -3'

Sequencing Primer
(F):5'- CACACTTGGAGGGCTTGATTCC -3'
(R):5'- AACCGTGGTCAAGCACG -3'
Posted On2015-06-12