Incidental Mutation 'R4166:Prol1'
ID320576
Institutional Source Beutler Lab
Gene Symbol Prol1
Ensembl Gene ENSMUSG00000064156
Gene Nameproline rich, lacrimal 1
SynonymsMuc10
MMRRC Submission 041639-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R4166 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location88317312-88328814 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88328671 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 307 (I307F)
Ref Sequence ENSEMBL: ENSMUSP00000132678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170832]
Predicted Effect unknown
Transcript: ENSMUST00000170832
AA Change: I307F
SMART Domains Protein: ENSMUSP00000132678
Gene: ENSMUSG00000064156
AA Change: I307F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 40 52 N/A INTRINSIC
low complexity region 99 295 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,660,955 T1018A possibly damaging Het
9230110C19Rik A T 9: 8,026,070 L167Q probably damaging Het
Aak1 T A 6: 86,850,062 F4I probably damaging Het
Adamts8 G T 9: 30,951,388 E296D probably benign Het
Ankrd35 T A 3: 96,679,155 probably null Het
Arhgap20 G A 9: 51,826,835 probably null Het
Bhmt T A 13: 93,625,499 probably benign Het
Cacna1b C A 2: 24,677,911 R1055L probably benign Het
Cdk5r1 A G 11: 80,478,209 Y234C probably damaging Het
Cdx2 G T 5: 147,306,729 A85D possibly damaging Het
Cenpe G A 3: 135,243,718 G88D probably damaging Het
Dennd5a A C 7: 109,926,825 probably null Het
Erich6 G A 3: 58,618,808 A591V probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fbln5 A G 12: 101,757,359 V374A probably damaging Het
Fmn1 G A 2: 113,636,735 S1327N probably benign Het
Fnip2 A T 3: 79,462,135 V1081E probably damaging Het
Gm5174 A G 10: 86,656,933 noncoding transcript Het
Gpaa1 A C 15: 76,332,467 probably benign Het
Grina T A 15: 76,249,329 L334Q probably damaging Het
Gulp1 T A 1: 44,708,669 Y27* probably null Het
Kdm3b A T 18: 34,795,744 I183F probably benign Het
Loxhd1 A T 18: 77,372,329 I758F probably damaging Het
Msi2 T C 11: 88,347,088 H346R probably benign Het
Naip6 T A 13: 100,316,149 I135F probably benign Het
Npr3 T G 15: 11,848,513 E202A probably benign Het
Nsun4 A T 4: 116,034,051 L377Q probably damaging Het
Olfr293 C A 7: 86,664,394 T244N probably damaging Het
Oog2 A C 4: 144,194,841 H107P probably damaging Het
Otof A G 5: 30,382,418 L1032P probably damaging Het
Pcdh9 T A 14: 93,887,520 R405* probably null Het
Pcdhb19 T A 18: 37,499,190 N679K probably benign Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Pycr1 T C 11: 120,642,123 I104V probably benign Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rb1cc1 T C 1: 6,265,663 probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Skint3 A G 4: 112,255,635 I147M possibly damaging Het
Slc22a14 T G 9: 119,178,432 M304L probably benign Het
Slc22a14 T C 9: 119,179,868 N178S possibly damaging Het
Slc2a1 T G 4: 119,133,116 I179S probably damaging Het
Slco2b1 G T 7: 99,660,126 T666N probably benign Het
Smap1 T C 1: 23,848,425 M258V probably benign Het
Smr3a A T 5: 88,008,154 probably benign Het
Stt3b T A 9: 115,254,901 E402D probably damaging Het
Sync T C 4: 129,306,742 probably benign Het
Tbx20 T A 9: 24,769,744 I151F probably damaging Het
Tomm22 C A 15: 79,671,005 probably benign Het
Trank1 C A 9: 111,373,524 Y1652* probably null Het
Trim34a T A 7: 104,261,016 C342S probably benign Het
Txnl4a T A 18: 80,222,256 M112K probably benign Het
Zfp146 A G 7: 30,162,440 V59A possibly damaging Het
Other mutations in Prol1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Prol1 APN 5 88327859 missense probably benign 0.31
IGL00500:Prol1 APN 5 88328691 makesense probably null
IGL01943:Prol1 APN 5 88327961 missense probably benign 0.03
IGL03291:Prol1 APN 5 88328520 missense unknown
R2144:Prol1 UTSW 5 88328395 missense unknown
R2888:Prol1 UTSW 5 88328309 missense unknown
R3849:Prol1 UTSW 5 88328617 missense unknown
R4078:Prol1 UTSW 5 88328216 missense unknown
R4079:Prol1 UTSW 5 88328216 missense unknown
R5447:Prol1 UTSW 5 88328266 missense unknown
R5709:Prol1 UTSW 5 88327852 nonsense probably null
R6253:Prol1 UTSW 5 88327877 missense probably damaging 0.97
R7804:Prol1 UTSW 5 88328405 missense unknown
Predicted Primers PCR Primer
(F):5'- AACCACAAATGCAACCACACCA -3'
(R):5'- GCCTGACCATGCCTACATAA -3'

Sequencing Primer
(F):5'- TGCAACCACACCAGCAAC -3'
(R):5'- ACCAAACCTGTTTAGCATTGGTGG -3'
Posted On2015-06-12