Mutagenetix > Incidental Mutation

Incidental Mutation 'R4166:Gm5174'

320592

Institutional Source

Beutler Lab

Gene Symbol

Gm5174

Ensembl Gene

ENSMUSG00000090308

Gene Name

predicted gene 5174

Synonyms

MMRRC Submission

041639-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.113) question?

Stock #

R4166 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86655939-86657381 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

A to G at 86656933 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171131

SMART Domains

Protein: ENSMUSP00000129952
Gene: ENSMUSG00000090308

Domain	Start	End	E-Value	Type
S_TKc	14	262	5.59e-86	SMART
UBA	276	313	1.28e-3	SMART
low complexity region	447	462	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219608

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.8%

Validation Efficiency

100% (56/56)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	T	C	14: 32,660,955	T1018A	possibly damaging	Het
9230110C19Rik	A	T	9: 8,026,070	L167Q	probably damaging	Het
Aak1	T	A	6: 86,850,062	F4I	probably damaging	Het
Adamts8	G	T	9: 30,951,388	E296D	probably benign	Het
Ankrd35	T	A	3: 96,679,155		probably null	Het
Arhgap20	G	A	9: 51,826,835		probably null	Het
Bhmt	T	A	13: 93,625,499		probably benign	Het
Cacna1b	C	A	2: 24,677,911	R1055L	probably benign	Het
Cdk5r1	A	G	11: 80,478,209	Y234C	probably damaging	Het
Cdx2	G	T	5: 147,306,729	A85D	possibly damaging	Het
Cenpe	G	A	3: 135,243,718	G88D	probably damaging	Het
Dennd5a	A	C	7: 109,926,825		probably null	Het
Erich6	G	A	3: 58,618,808	A591V	probably damaging	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Fbln5	A	G	12: 101,757,359	V374A	probably damaging	Het
Fmn1	G	A	2: 113,636,735	S1327N	probably benign	Het
Fnip2	A	T	3: 79,462,135	V1081E	probably damaging	Het
Gpaa1	A	C	15: 76,332,467		probably benign	Het
Grina	T	A	15: 76,249,329	L334Q	probably damaging	Het
Gulp1	T	A	1: 44,708,669	Y27*	probably null	Het
Kdm3b	A	T	18: 34,795,744	I183F	probably benign	Het
Loxhd1	A	T	18: 77,372,329	I758F	probably damaging	Het
Msi2	T	C	11: 88,347,088	H346R	probably benign	Het
Naip6	T	A	13: 100,316,149	I135F	probably benign	Het
Npr3	T	G	15: 11,848,513	E202A	probably benign	Het
Nsun4	A	T	4: 116,034,051	L377Q	probably damaging	Het
Olfr293	C	A	7: 86,664,394	T244N	probably damaging	Het
Oog2	A	C	4: 144,194,841	H107P	probably damaging	Het
Otof	A	G	5: 30,382,418	L1032P	probably damaging	Het
Pcdh9	T	A	14: 93,887,520	R405*	probably null	Het
Pcdhb19	T	A	18: 37,499,190	N679K	probably benign	Het
Pigr	G	A	1: 130,841,817	D122N	probably benign	Het
Prol1	A	T	5: 88,328,671	I307F	unknown	Het
Pycr1	T	C	11: 120,642,123	I104V	probably benign	Het
Ralgapa1	C	T	12: 55,640,644	R2019Q	probably damaging	Het
Rb1cc1	T	C	1: 6,265,663		probably benign	Het
Skint11	C	A	4: 114,244,659	Q99K	probably benign	Het
Skint3	A	G	4: 112,255,635	I147M	possibly damaging	Het
Slc22a14	T	G	9: 119,178,432	M304L	probably benign	Het
Slc22a14	T	C	9: 119,179,868	N178S	possibly damaging	Het
Slc2a1	T	G	4: 119,133,116	I179S	probably damaging	Het
Slco2b1	G	T	7: 99,660,126	T666N	probably benign	Het
Smap1	T	C	1: 23,848,425	M258V	probably benign	Het
Smr3a	A	T	5: 88,008,154		probably benign	Het
Stt3b	T	A	9: 115,254,901	E402D	probably damaging	Het
Sync	T	C	4: 129,306,742		probably benign	Het
Tbx20	T	A	9: 24,769,744	I151F	probably damaging	Het
Tomm22	C	A	15: 79,671,005		probably benign	Het
Trank1	C	A	9: 111,373,524	Y1652*	probably null	Het
Trim34a	T	A	7: 104,261,016	C342S	probably benign	Het
Txnl4a	T	A	18: 80,222,256	M112K	probably benign	Het
Zfp146	A	G	7: 30,162,440	V59A	possibly damaging	Het

Other mutations in Gm5174

Allele	Source	Chr	Coord	Type	Predicted Effect
Laco	UTSW	10	86656108	unclassified	noncoding transcript
R1083:Gm5174	UTSW	10	86656108	unclassified	noncoding transcript
R1199:Gm5174	UTSW	10	86657325	unclassified	noncoding transcript
R1296:Gm5174	UTSW	10	86657002	unclassified	noncoding transcript
R1715:Gm5174	UTSW	10	86656912	unclassified	noncoding transcript
R1957:Gm5174	UTSW	10	86656753	unclassified	noncoding transcript
R2221:Gm5174	UTSW	10	86656508	unclassified	noncoding transcript
R2223:Gm5174	UTSW	10	86656508	unclassified	noncoding transcript
R3104:Gm5174	UTSW	10	86656655	unclassified	noncoding transcript
R4165:Gm5174	UTSW	10	86656933	unclassified	noncoding transcript
R4243:Gm5174	UTSW	10	86656280	unclassified	noncoding transcript
R4244:Gm5174	UTSW	10	86656280	unclassified	noncoding transcript
R5024:Gm5174	UTSW	10	86656587	unclassified	noncoding transcript
R5292:Gm5174	UTSW	10	86656698	unclassified	noncoding transcript
R5586:Gm5174	UTSW	10	86656545	unclassified	noncoding transcript
R5864:Gm5174	UTSW	10	86657181	unclassified	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- CATTGAGAAACATCCTTGGGTC -3'
(R):5'- AGGCATGGAGTCACTTCTGG -3'

Sequencing Primer
(F):5'- ACATCCTTGGGTCACGAAATG -3'
(R):5'- GCATGGAGTCACTTCTGGTCAAC -3'

Posted On

2015-06-12