Incidental Mutation 'R4166:3425401B19Rik'
ID320600
Institutional Source Beutler Lab
Gene Symbol 3425401B19Rik
Ensembl Gene ENSMUSG00000071540
Gene NameRIKEN cDNA 3425401B19 gene
Synonyms
MMRRC Submission 041639-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R4166 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location32659119-32685293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32660955 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1018 (T1018A)
Ref Sequence ENSEMBL: ENSMUSP00000093741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096038]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096038
AA Change: T1018A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000093741
Gene: ENSMUSG00000071540
AA Change: T1018A

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 386 399 N/A INTRINSIC
low complexity region 587 602 N/A INTRINSIC
low complexity region 605 624 N/A INTRINSIC
low complexity region 728 744 N/A INTRINSIC
low complexity region 1002 1015 N/A INTRINSIC
low complexity region 1086 1097 N/A INTRINSIC
low complexity region 1147 1158 N/A INTRINSIC
low complexity region 1161 1176 N/A INTRINSIC
Pfam:DUF4585 1251 1322 6.5e-30 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A T 9: 8,026,070 L167Q probably damaging Het
Aak1 T A 6: 86,850,062 F4I probably damaging Het
Adamts8 G T 9: 30,951,388 E296D probably benign Het
Ankrd35 T A 3: 96,679,155 probably null Het
Arhgap20 G A 9: 51,826,835 probably null Het
Bhmt T A 13: 93,625,499 probably benign Het
Cacna1b C A 2: 24,677,911 R1055L probably benign Het
Cdk5r1 A G 11: 80,478,209 Y234C probably damaging Het
Cdx2 G T 5: 147,306,729 A85D possibly damaging Het
Cenpe G A 3: 135,243,718 G88D probably damaging Het
Dennd5a A C 7: 109,926,825 probably null Het
Erich6 G A 3: 58,618,808 A591V probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fbln5 A G 12: 101,757,359 V374A probably damaging Het
Fmn1 G A 2: 113,636,735 S1327N probably benign Het
Fnip2 A T 3: 79,462,135 V1081E probably damaging Het
Gm5174 A G 10: 86,656,933 noncoding transcript Het
Gpaa1 A C 15: 76,332,467 probably benign Het
Grina T A 15: 76,249,329 L334Q probably damaging Het
Gulp1 T A 1: 44,708,669 Y27* probably null Het
Kdm3b A T 18: 34,795,744 I183F probably benign Het
Loxhd1 A T 18: 77,372,329 I758F probably damaging Het
Msi2 T C 11: 88,347,088 H346R probably benign Het
Naip6 T A 13: 100,316,149 I135F probably benign Het
Npr3 T G 15: 11,848,513 E202A probably benign Het
Nsun4 A T 4: 116,034,051 L377Q probably damaging Het
Olfr293 C A 7: 86,664,394 T244N probably damaging Het
Oog2 A C 4: 144,194,841 H107P probably damaging Het
Otof A G 5: 30,382,418 L1032P probably damaging Het
Pcdh9 T A 14: 93,887,520 R405* probably null Het
Pcdhb19 T A 18: 37,499,190 N679K probably benign Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prol1 A T 5: 88,328,671 I307F unknown Het
Pycr1 T C 11: 120,642,123 I104V probably benign Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rb1cc1 T C 1: 6,265,663 probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Skint3 A G 4: 112,255,635 I147M possibly damaging Het
Slc22a14 T G 9: 119,178,432 M304L probably benign Het
Slc22a14 T C 9: 119,179,868 N178S possibly damaging Het
Slc2a1 T G 4: 119,133,116 I179S probably damaging Het
Slco2b1 G T 7: 99,660,126 T666N probably benign Het
Smap1 T C 1: 23,848,425 M258V probably benign Het
Smr3a A T 5: 88,008,154 probably benign Het
Stt3b T A 9: 115,254,901 E402D probably damaging Het
Sync T C 4: 129,306,742 probably benign Het
Tbx20 T A 9: 24,769,744 I151F probably damaging Het
Tomm22 C A 15: 79,671,005 probably benign Het
Trank1 C A 9: 111,373,524 Y1652* probably null Het
Trim34a T A 7: 104,261,016 C342S probably benign Het
Txnl4a T A 18: 80,222,256 M112K probably benign Het
Zfp146 A G 7: 30,162,440 V59A possibly damaging Het
Other mutations in 3425401B19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:3425401B19Rik APN 14 32660916 missense probably benign 0.18
IGL00844:3425401B19Rik APN 14 32662999 nonsense probably null
IGL01292:3425401B19Rik APN 14 32660874 missense probably benign 0.18
IGL01295:3425401B19Rik APN 14 32661936 missense possibly damaging 0.53
IGL01457:3425401B19Rik APN 14 32660951 missense probably benign
IGL01470:3425401B19Rik APN 14 32660457 missense possibly damaging 0.53
IGL01612:3425401B19Rik APN 14 32660031 missense possibly damaging 0.53
IGL01974:3425401B19Rik APN 14 32659805 missense possibly damaging 0.85
IGL02095:3425401B19Rik APN 14 32661626 missense probably benign 0.33
IGL02138:3425401B19Rik APN 14 32662715 missense possibly damaging 0.83
IGL02178:3425401B19Rik APN 14 32662461 missense possibly damaging 0.83
IGL02245:3425401B19Rik APN 14 32659815 missense probably benign 0.03
IGL02529:3425401B19Rik APN 14 32661233 missense probably benign
IGL03401:3425401B19Rik APN 14 32662266 nonsense probably null
PIT4515001:3425401B19Rik UTSW 14 32661111 nonsense probably null
R0233:3425401B19Rik UTSW 14 32663373 missense probably benign
R0233:3425401B19Rik UTSW 14 32663373 missense probably benign
R0320:3425401B19Rik UTSW 14 32662614 missense probably benign 0.19
R0519:3425401B19Rik UTSW 14 32662962 missense possibly damaging 0.92
R0551:3425401B19Rik UTSW 14 32662641 missense probably benign 0.03
R0759:3425401B19Rik UTSW 14 32662497 missense possibly damaging 0.93
R0831:3425401B19Rik UTSW 14 32662271 missense probably benign 0.01
R1124:3425401B19Rik UTSW 14 32662082 missense possibly damaging 0.53
R1346:3425401B19Rik UTSW 14 32660814 missense probably benign 0.07
R1997:3425401B19Rik UTSW 14 32660048 missense possibly damaging 0.71
R2055:3425401B19Rik UTSW 14 32662551 missense probably benign
R2212:3425401B19Rik UTSW 14 32661602 missense probably benign 0.33
R2416:3425401B19Rik UTSW 14 32663834 missense probably benign 0.04
R2441:3425401B19Rik UTSW 14 32663492 missense possibly damaging 0.53
R2513:3425401B19Rik UTSW 14 32661852 missense possibly damaging 0.53
R3414:3425401B19Rik UTSW 14 32661602 missense probably benign 0.33
R3800:3425401B19Rik UTSW 14 32663068 missense possibly damaging 0.83
R3809:3425401B19Rik UTSW 14 32663693 missense possibly damaging 0.96
R4581:3425401B19Rik UTSW 14 32661871 missense possibly damaging 0.73
R4721:3425401B19Rik UTSW 14 32663150 missense probably benign 0.01
R4769:3425401B19Rik UTSW 14 32660217 missense probably benign 0.32
R4809:3425401B19Rik UTSW 14 32662631 missense probably benign 0.19
R4919:3425401B19Rik UTSW 14 32663288 missense possibly damaging 0.85
R4925:3425401B19Rik UTSW 14 32663180 missense possibly damaging 0.86
R4972:3425401B19Rik UTSW 14 32661404 missense possibly damaging 0.73
R5068:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5069:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5070:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5258:3425401B19Rik UTSW 14 32663309 missense probably damaging 0.98
R5435:3425401B19Rik UTSW 14 32661456 missense probably benign 0.18
R5549:3425401B19Rik UTSW 14 32663036 missense possibly damaging 0.68
R5678:3425401B19Rik UTSW 14 32662053 missense probably damaging 0.97
R5680:3425401B19Rik UTSW 14 32662053 missense probably damaging 0.97
R5872:3425401B19Rik UTSW 14 32660352 missense possibly damaging 0.73
R5896:3425401B19Rik UTSW 14 32661675 nonsense probably null
R5940:3425401B19Rik UTSW 14 32662688 missense possibly damaging 0.91
R6044:3425401B19Rik UTSW 14 32660657 missense possibly damaging 0.53
R6136:3425401B19Rik UTSW 14 32662282 missense possibly damaging 0.70
R6277:3425401B19Rik UTSW 14 32663694 missense possibly damaging 0.86
R6385:3425401B19Rik UTSW 14 32661279 missense probably benign 0.01
R6728:3425401B19Rik UTSW 14 32662688 missense possibly damaging 0.91
R6984:3425401B19Rik UTSW 14 32661980 missense probably benign 0.00
R7047:3425401B19Rik UTSW 14 32660174 missense possibly damaging 0.89
R7249:3425401B19Rik UTSW 14 32663314 missense possibly damaging 0.73
R7493:3425401B19Rik UTSW 14 32663300 missense possibly damaging 0.96
R7575:3425401B19Rik UTSW 14 32662632 missense probably benign 0.03
R7742:3425401B19Rik UTSW 14 32662757 missense possibly damaging 0.68
R7747:3425401B19Rik UTSW 14 32663069 missense possibly damaging 0.83
R7784:3425401B19Rik UTSW 14 32659840 missense probably benign 0.00
R8098:3425401B19Rik UTSW 14 32662661 missense probably damaging 0.99
R8111:3425401B19Rik UTSW 14 32660309 nonsense probably null
R8171:3425401B19Rik UTSW 14 32662025 missense probably benign
R8276:3425401B19Rik UTSW 14 32663928 missense probably damaging 0.97
R8330:3425401B19Rik UTSW 14 32659793 missense probably damaging 0.98
R8422:3425401B19Rik UTSW 14 32662297 missense possibly damaging 0.84
X0025:3425401B19Rik UTSW 14 32662469 missense probably damaging 0.98
Z1177:3425401B19Rik UTSW 14 32659808 missense possibly damaging 0.86
Z1177:3425401B19Rik UTSW 14 32661398 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCCTCTTCCCAAATACTGC -3'
(R):5'- TCTCCAATAACGACGTGCCG -3'

Sequencing Primer
(F):5'- CCAAATACTGCTGGCTGCG -3'
(R):5'- AGCCCAGGATGAGACTTCTC -3'
Posted On2015-06-12