Incidental Mutation 'R4166:Pcdh9'
ID320601
Institutional Source Beutler Lab
Gene Symbol Pcdh9
Ensembl Gene ENSMUSG00000055421
Gene Nameprotocadherin 9
SynonymsC630029H24Rik, A730003J17Rik, C530050I23Rik, LOC382930, 1500001L12Rik
MMRRC Submission 041639-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.250) question?
Stock #R4166 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location93013410-93890679 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 93887520 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 405 (R405*)
Ref Sequence ENSEMBL: ENSMUSP00000141396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068992] [ENSMUST00000192221] [ENSMUST00000193901] [ENSMUST00000194056] [ENSMUST00000195376] [ENSMUST00000195826]
Predicted Effect probably null
Transcript: ENSMUST00000068992
AA Change: R405*
SMART Domains Protein: ENSMUSP00000070935
Gene: ENSMUSG00000055421
AA Change: R405*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 8.37e-3 SMART
CA 164 250 1.01e-20 SMART
CA 274 356 2.34e-25 SMART
CA 386 467 2.14e-19 SMART
CA 491 570 4.27e-28 SMART
CA 594 673 2.45e-28 SMART
CA 700 782 1.01e-6 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000192221
AA Change: R282*
SMART Domains Protein: ENSMUSP00000142260
Gene: ENSMUSG00000055421
AA Change: R282*

DomainStartEndE-ValueType
CA 41 127 1.01e-20 SMART
CA 151 233 2.34e-25 SMART
CA 263 344 2.14e-19 SMART
CA 368 447 4.27e-28 SMART
CA 471 550 2.45e-28 SMART
CA 577 659 1.01e-6 SMART
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 735 760 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192817
Predicted Effect probably null
Transcript: ENSMUST00000193901
AA Change: R405*
SMART Domains Protein: ENSMUSP00000141759
Gene: ENSMUSG00000055421
AA Change: R405*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 8.37e-3 SMART
CA 164 250 1.01e-20 SMART
CA 274 356 2.34e-25 SMART
CA 386 467 2.14e-19 SMART
CA 491 570 4.27e-28 SMART
CA 594 673 2.45e-28 SMART
CA 700 782 1.01e-6 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000194056
AA Change: R405*
SMART Domains Protein: ENSMUSP00000141602
Gene: ENSMUSG00000055421
AA Change: R405*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 4.1e-5 SMART
CA 164 250 4.8e-23 SMART
CA 274 356 1.2e-27 SMART
CA 386 467 1.1e-21 SMART
CA 491 570 2e-30 SMART
CA 594 673 1.2e-30 SMART
CA 700 782 4.9e-9 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 860 873 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194129
Predicted Effect probably null
Transcript: ENSMUST00000195376
AA Change: R405*
SMART Domains Protein: ENSMUSP00000142224
Gene: ENSMUSG00000055421
AA Change: R405*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 4.1e-5 SMART
CA 164 250 4.8e-23 SMART
CA 274 356 1.2e-27 SMART
CA 386 467 1.1e-21 SMART
CA 491 570 2e-30 SMART
CA 594 673 1.2e-30 SMART
CA 700 782 4.9e-9 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000195826
AA Change: R405*
SMART Domains Protein: ENSMUSP00000141396
Gene: ENSMUSG00000055421
AA Change: R405*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 8.37e-3 SMART
CA 164 250 1.01e-20 SMART
CA 274 356 2.34e-25 SMART
CA 386 467 2.14e-19 SMART
CA 491 570 4.27e-28 SMART
CA 594 673 2.45e-28 SMART
CA 700 782 1.01e-6 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: This gene encodes a member of the protocadherin family, and cadherin superfamily, of transmembrane proteins containing cadherin domains. These proteins mediate cell adhesion in neural tissues in the presence of calcium. The encoded protein may be involved in signaling at neuronal synaptic junctions. Sharing a characteristic with other protocadherin genes, this gene has a notably large exon that encodes multiple cadherin domains and a transmembrane region. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired long-term social and bject recognition and sensorimotor development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,660,955 T1018A possibly damaging Het
9230110C19Rik A T 9: 8,026,070 L167Q probably damaging Het
Aak1 T A 6: 86,850,062 F4I probably damaging Het
Adamts8 G T 9: 30,951,388 E296D probably benign Het
Ankrd35 T A 3: 96,679,155 probably null Het
Arhgap20 G A 9: 51,826,835 probably null Het
Bhmt T A 13: 93,625,499 probably benign Het
Cacna1b C A 2: 24,677,911 R1055L probably benign Het
Cdk5r1 A G 11: 80,478,209 Y234C probably damaging Het
Cdx2 G T 5: 147,306,729 A85D possibly damaging Het
Cenpe G A 3: 135,243,718 G88D probably damaging Het
Dennd5a A C 7: 109,926,825 probably null Het
Erich6 G A 3: 58,618,808 A591V probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fbln5 A G 12: 101,757,359 V374A probably damaging Het
Fmn1 G A 2: 113,636,735 S1327N probably benign Het
Fnip2 A T 3: 79,462,135 V1081E probably damaging Het
Gm5174 A G 10: 86,656,933 noncoding transcript Het
Gpaa1 A C 15: 76,332,467 probably benign Het
Grina T A 15: 76,249,329 L334Q probably damaging Het
Gulp1 T A 1: 44,708,669 Y27* probably null Het
Kdm3b A T 18: 34,795,744 I183F probably benign Het
Loxhd1 A T 18: 77,372,329 I758F probably damaging Het
Msi2 T C 11: 88,347,088 H346R probably benign Het
Naip6 T A 13: 100,316,149 I135F probably benign Het
Npr3 T G 15: 11,848,513 E202A probably benign Het
Nsun4 A T 4: 116,034,051 L377Q probably damaging Het
Olfr293 C A 7: 86,664,394 T244N probably damaging Het
Oog2 A C 4: 144,194,841 H107P probably damaging Het
Otof A G 5: 30,382,418 L1032P probably damaging Het
Pcdhb19 T A 18: 37,499,190 N679K probably benign Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prol1 A T 5: 88,328,671 I307F unknown Het
Pycr1 T C 11: 120,642,123 I104V probably benign Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rb1cc1 T C 1: 6,265,663 probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Skint3 A G 4: 112,255,635 I147M possibly damaging Het
Slc22a14 T G 9: 119,178,432 M304L probably benign Het
Slc22a14 T C 9: 119,179,868 N178S possibly damaging Het
Slc2a1 T G 4: 119,133,116 I179S probably damaging Het
Slco2b1 G T 7: 99,660,126 T666N probably benign Het
Smap1 T C 1: 23,848,425 M258V probably benign Het
Smr3a A T 5: 88,008,154 probably benign Het
Stt3b T A 9: 115,254,901 E402D probably damaging Het
Sync T C 4: 129,306,742 probably benign Het
Tbx20 T A 9: 24,769,744 I151F probably damaging Het
Tomm22 C A 15: 79,671,005 probably benign Het
Trank1 C A 9: 111,373,524 Y1652* probably null Het
Trim34a T A 7: 104,261,016 C342S probably benign Het
Txnl4a T A 18: 80,222,256 M112K probably benign Het
Zfp146 A G 7: 30,162,440 V59A possibly damaging Het
Other mutations in Pcdh9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Pcdh9 APN 14 93326694 missense probably damaging 1.00
IGL02183:Pcdh9 APN 14 93886284 missense probably benign 0.01
IGL02244:Pcdh9 APN 14 93326768 missense probably damaging 1.00
IGL02571:Pcdh9 APN 14 93560587 splice site probably benign
IGL03018:Pcdh9 APN 14 93015576 missense probably null
I1329:Pcdh9 UTSW 14 93886209 missense probably benign 0.00
R0027:Pcdh9 UTSW 14 93888645 missense probably null 0.99
R0027:Pcdh9 UTSW 14 93888645 missense probably null 0.99
R0477:Pcdh9 UTSW 14 93887678 missense probably damaging 0.99
R0499:Pcdh9 UTSW 14 93886235 missense probably damaging 1.00
R0787:Pcdh9 UTSW 14 93886757 missense possibly damaging 0.88
R1205:Pcdh9 UTSW 14 93886065 missense probably benign 0.01
R1616:Pcdh9 UTSW 14 93886969 nonsense probably null
R1620:Pcdh9 UTSW 14 93888305 missense probably damaging 1.00
R1622:Pcdh9 UTSW 14 93885875 missense probably benign 0.03
R1708:Pcdh9 UTSW 14 93888305 missense probably damaging 1.00
R1721:Pcdh9 UTSW 14 93888035 missense probably damaging 1.00
R1753:Pcdh9 UTSW 14 93887225 missense probably benign 0.33
R1799:Pcdh9 UTSW 14 93888671 missense probably benign 0.36
R1867:Pcdh9 UTSW 14 93888035 missense probably damaging 1.00
R1987:Pcdh9 UTSW 14 93888305 missense probably damaging 1.00
R1988:Pcdh9 UTSW 14 93888305 missense probably damaging 1.00
R2444:Pcdh9 UTSW 14 93886791 missense probably benign 0.10
R3895:Pcdh9 UTSW 14 93887538 missense probably damaging 1.00
R3926:Pcdh9 UTSW 14 93886810 nonsense probably null
R4429:Pcdh9 UTSW 14 93887384 missense probably damaging 0.96
R4589:Pcdh9 UTSW 14 93888192 missense probably damaging 1.00
R4604:Pcdh9 UTSW 14 93887180 missense probably damaging 1.00
R4607:Pcdh9 UTSW 14 93015573 missense probably benign 0.08
R4621:Pcdh9 UTSW 14 93887643 missense probably benign 0.12
R4624:Pcdh9 UTSW 14 93886409 missense probably damaging 1.00
R4712:Pcdh9 UTSW 14 93888631 missense probably damaging 1.00
R4788:Pcdh9 UTSW 14 93887415 missense probably damaging 1.00
R4831:Pcdh9 UTSW 14 93887941 missense probably damaging 1.00
R4883:Pcdh9 UTSW 14 93888728 missense possibly damaging 0.83
R5034:Pcdh9 UTSW 14 93326849 missense probably benign 0.13
R5175:Pcdh9 UTSW 14 93888443 missense probably damaging 1.00
R5637:Pcdh9 UTSW 14 93885762 missense possibly damaging 0.91
R5743:Pcdh9 UTSW 14 93886724 missense probably damaging 1.00
R5753:Pcdh9 UTSW 14 93888161 missense probably damaging 1.00
R5770:Pcdh9 UTSW 14 93886943 missense probably damaging 1.00
R5900:Pcdh9 UTSW 14 93326720 missense probably damaging 0.98
R5986:Pcdh9 UTSW 14 93887048 missense probably damaging 1.00
R6052:Pcdh9 UTSW 14 93885846 missense probably benign 0.40
R6113:Pcdh9 UTSW 14 93887108 missense probably damaging 1.00
R6223:Pcdh9 UTSW 14 93015733 missense probably benign 0.18
R6415:Pcdh9 UTSW 14 93015842 missense possibly damaging 0.83
R6435:Pcdh9 UTSW 14 93887844 missense probably benign 0.01
R7064:Pcdh9 UTSW 14 93886149 missense probably damaging 1.00
R7143:Pcdh9 UTSW 14 93888272 missense probably damaging 0.99
R7219:Pcdh9 UTSW 14 93015780 missense possibly damaging 0.87
R7262:Pcdh9 UTSW 14 93015705 missense probably benign 0.01
R7354:Pcdh9 UTSW 14 93888270 missense probably benign 0.28
R7369:Pcdh9 UTSW 14 93886367 missense possibly damaging 0.67
R7427:Pcdh9 UTSW 14 93887111 missense probably damaging 1.00
R7428:Pcdh9 UTSW 14 93887111 missense probably damaging 1.00
X0012:Pcdh9 UTSW 14 93886644 missense possibly damaging 0.71
X0067:Pcdh9 UTSW 14 93326849 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ACAGCTCAATTACAGGCTGG -3'
(R):5'- GTGACCATCAATGTCACCGATG -3'

Sequencing Primer
(F):5'- CAATTACAGGCTGGTTGAAAATTGG -3'
(R):5'- GACCATCAATGTCACCGATGTAAATG -3'
Posted On2015-06-12