Incidental Mutation 'R4166:Espl1'
ID 320606
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Name extra spindle pole bodies 1, separase
Synonyms SSE, ESP1, PRCE, Cerp, PRCE, separase
MMRRC Submission 041639-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4166 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 102296266-102324357 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102312989 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 944 (I944V)
Ref Sequence ENSEMBL: ENSMUSP00000155304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]
AlphaFold P60330
Predicted Effect probably damaging
Transcript: ENSMUST00000064924
AA Change: I944V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: I944V

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229050
AA Change: I944V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230120
Meta Mutation Damage Score 0.1426 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,660,955 T1018A possibly damaging Het
9230110C19Rik A T 9: 8,026,070 L167Q probably damaging Het
Aak1 T A 6: 86,850,062 F4I probably damaging Het
Adamts8 G T 9: 30,951,388 E296D probably benign Het
Ankrd35 T A 3: 96,679,155 probably null Het
Arhgap20 G A 9: 51,826,835 probably null Het
Bhmt T A 13: 93,625,499 probably benign Het
Cacna1b C A 2: 24,677,911 R1055L probably benign Het
Cdk5r1 A G 11: 80,478,209 Y234C probably damaging Het
Cdx2 G T 5: 147,306,729 A85D possibly damaging Het
Cenpe G A 3: 135,243,718 G88D probably damaging Het
Dennd5a A C 7: 109,926,825 probably null Het
Erich6 G A 3: 58,618,808 A591V probably damaging Het
Fbln5 A G 12: 101,757,359 V374A probably damaging Het
Fmn1 G A 2: 113,636,735 S1327N probably benign Het
Fnip2 A T 3: 79,462,135 V1081E probably damaging Het
Gm5174 A G 10: 86,656,933 noncoding transcript Het
Gpaa1 A C 15: 76,332,467 probably benign Het
Grina T A 15: 76,249,329 L334Q probably damaging Het
Gulp1 T A 1: 44,708,669 Y27* probably null Het
Kdm3b A T 18: 34,795,744 I183F probably benign Het
Loxhd1 A T 18: 77,372,329 I758F probably damaging Het
Msi2 T C 11: 88,347,088 H346R probably benign Het
Naip6 T A 13: 100,316,149 I135F probably benign Het
Npr3 T G 15: 11,848,513 E202A probably benign Het
Nsun4 A T 4: 116,034,051 L377Q probably damaging Het
Olfr293 C A 7: 86,664,394 T244N probably damaging Het
Oog2 A C 4: 144,194,841 H107P probably damaging Het
Otof A G 5: 30,382,418 L1032P probably damaging Het
Pcdh9 T A 14: 93,887,520 R405* probably null Het
Pcdhb19 T A 18: 37,499,190 N679K probably benign Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prol1 A T 5: 88,328,671 I307F unknown Het
Pycr1 T C 11: 120,642,123 I104V probably benign Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rb1cc1 T C 1: 6,265,663 probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Skint3 A G 4: 112,255,635 I147M possibly damaging Het
Slc22a14 T G 9: 119,178,432 M304L probably benign Het
Slc22a14 T C 9: 119,179,868 N178S possibly damaging Het
Slc2a1 T G 4: 119,133,116 I179S probably damaging Het
Slco2b1 G T 7: 99,660,126 T666N probably benign Het
Smap1 T C 1: 23,848,425 M258V probably benign Het
Smr3a A T 5: 88,008,154 probably benign Het
Stt3b T A 9: 115,254,901 E402D probably damaging Het
Sync T C 4: 129,306,742 probably benign Het
Tbx20 T A 9: 24,769,744 I151F probably damaging Het
Tomm22 C A 15: 79,671,005 probably benign Het
Trank1 C A 9: 111,373,524 Y1652* probably null Het
Trim34a T A 7: 104,261,016 C342S probably benign Het
Txnl4a T A 18: 80,222,256 M112K probably benign Het
Zfp146 A G 7: 30,162,440 V59A possibly damaging Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102299813 missense probably damaging 1.00
IGL00839:Espl1 APN 15 102320547 unclassified probably benign
IGL00919:Espl1 APN 15 102298629 missense probably benign 0.03
IGL01125:Espl1 APN 15 102322938 missense probably damaging 1.00
IGL01366:Espl1 APN 15 102319836 missense probably benign 0.00
IGL01488:Espl1 APN 15 102298739 missense probably benign
IGL01554:Espl1 APN 15 102313225 missense probably damaging 1.00
IGL01810:Espl1 APN 15 102298205 missense probably benign
IGL01959:Espl1 APN 15 102305662 splice site probably benign
IGL02267:Espl1 APN 15 102315664 missense probably benign 0.01
IGL02452:Espl1 APN 15 102299839 missense probably damaging 1.00
IGL02469:Espl1 APN 15 102314025 missense probably damaging 1.00
IGL02500:Espl1 APN 15 102315800 missense probably benign
IGL02630:Espl1 APN 15 102296818 missense probably benign 0.11
IGL02687:Espl1 APN 15 102313178 splice site probably benign
IGL02868:Espl1 APN 15 102313990 nonsense probably null
IGL02926:Espl1 APN 15 102299855 missense probably damaging 0.99
R0019:Espl1 UTSW 15 102306319 missense probably null 0.01
R0129:Espl1 UTSW 15 102316648 missense probably benign 0.00
R0184:Espl1 UTSW 15 102299216 missense probably benign 0.01
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0267:Espl1 UTSW 15 102313017 missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102303986 nonsense probably null
R0587:Espl1 UTSW 15 102303947 splice site probably benign
R0726:Espl1 UTSW 15 102322598 missense probably benign
R1186:Espl1 UTSW 15 102304039 missense probably benign 0.05
R1282:Espl1 UTSW 15 102315391 missense probably benign 0.00
R1428:Espl1 UTSW 15 102305685 missense probably benign 0.06
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1473:Espl1 UTSW 15 102320443 missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102298367 missense probably damaging 0.98
R1639:Espl1 UTSW 15 102320714 missense probably damaging 1.00
R1725:Espl1 UTSW 15 102313221 missense probably benign 0.08
R1748:Espl1 UTSW 15 102298529 missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102299013 missense probably benign
R1938:Espl1 UTSW 15 102305042 missense probably benign 0.00
R1954:Espl1 UTSW 15 102298388 missense probably damaging 1.00
R2009:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R2014:Espl1 UTSW 15 102322714 nonsense probably null
R2067:Espl1 UTSW 15 102299090 missense probably damaging 0.96
R2084:Espl1 UTSW 15 102296851 critical splice donor site probably null
R2164:Espl1 UTSW 15 102319588 missense probably damaging 1.00
R2204:Espl1 UTSW 15 102305905 missense probably damaging 1.00
R2220:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R2237:Espl1 UTSW 15 102315569 missense probably damaging 0.98
R2314:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3107:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3108:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3114:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3616:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3733:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3958:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3959:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3960:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4062:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4063:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4064:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4165:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4349:Espl1 UTSW 15 102319604 missense probably benign 0.26
R4373:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4376:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4377:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4516:Espl1 UTSW 15 102323236 missense probably benign 0.00
R4595:Espl1 UTSW 15 102298724 missense probably benign 0.01
R4884:Espl1 UTSW 15 102324070 missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102322323 critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102315241 missense probably damaging 0.98
R4931:Espl1 UTSW 15 102305730 missense probably benign 0.02
R4936:Espl1 UTSW 15 102304937 missense probably damaging 1.00
R5000:Espl1 UTSW 15 102298551 missense probably damaging 1.00
R5220:Espl1 UTSW 15 102298577 missense probably benign 0.03
R5329:Espl1 UTSW 15 102312518 missense probably damaging 0.97
R5501:Espl1 UTSW 15 102317130 missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102324030 missense probably damaging 1.00
R5848:Espl1 UTSW 15 102322576 missense probably benign 0.03
R5906:Espl1 UTSW 15 102296851 critical splice donor site probably null
R5978:Espl1 UTSW 15 102315774 missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102299888 missense probably damaging 0.99
R6313:Espl1 UTSW 15 102315812 missense probably benign 0.00
R6414:Espl1 UTSW 15 102315560 missense probably damaging 0.96
R6484:Espl1 UTSW 15 102323500 missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102299225 missense probably benign
R6928:Espl1 UTSW 15 102298907 missense probably benign 0.28
R6995:Espl1 UTSW 15 102304100 missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102316893 critical splice donor site probably null
R7062:Espl1 UTSW 15 102298896 missense probably benign 0.00
R7135:Espl1 UTSW 15 102319524 nonsense probably null
R7154:Espl1 UTSW 15 102324049 missense probably damaging 1.00
R7164:Espl1 UTSW 15 102313203 missense probably damaging 1.00
R7522:Espl1 UTSW 15 102305051 missense probably damaging 1.00
R7848:Espl1 UTSW 15 102316526 missense probably damaging 1.00
R7894:Espl1 UTSW 15 102304025 missense probably damaging 1.00
R8275:Espl1 UTSW 15 102302753 splice site probably benign
R8752:Espl1 UTSW 15 102306324 missense probably damaging 1.00
R9160:Espl1 UTSW 15 102298518 missense probably damaging 1.00
R9310:Espl1 UTSW 15 102296850 critical splice donor site probably null
R9385:Espl1 UTSW 15 102298750 missense probably damaging 0.99
X0062:Espl1 UTSW 15 102298397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCTGCTTGGAATGTTAG -3'
(R):5'- GACAGACATCAATGTGGAGCC -3'

Sequencing Primer
(F):5'- GGAAAGAGCTCTGTGTTCAATTAG -3'
(R):5'- TGGAGCCACAGTCGGATTCAC -3'
Posted On 2015-06-12