Incidental Mutation 'R4167:Kat14'
ID 320614
Institutional Source Beutler Lab
Gene Symbol Kat14
Ensembl Gene ENSMUSG00000027425
Gene Name lysine acetyltransferase 14
Synonyms D2Wsu131e, 2510008M08Rik, ATAC2, Csrp2bp, D2Ertd473e
MMRRC Submission 041008-MU
Accession Numbers

Genbank: NM_181417; MGI: 1917264

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4167 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 144368983-144407676 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 144394110 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 254 (E254G)
Ref Sequence ENSEMBL: ENSMUSP00000130785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028911] [ENSMUST00000147747]
AlphaFold Q8CID0
Predicted Effect probably damaging
Transcript: ENSMUST00000028911
AA Change: E465G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028911
Gene: ENSMUSG00000027425
AA Change: E465G

DomainStartEndE-ValueType
low complexity region 21 41 N/A INTRINSIC
low complexity region 310 334 N/A INTRINSIC
Pfam:Acetyltransf_10 640 748 7e-12 PFAM
Pfam:Acetyltransf_7 670 750 5.8e-12 PFAM
Pfam:Acetyltransf_1 675 749 7.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143318
Predicted Effect probably damaging
Transcript: ENSMUST00000147747
AA Change: E254G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130785
Gene: ENSMUSG00000027425
AA Change: E254G

DomainStartEndE-ValueType
low complexity region 99 123 N/A INTRINSIC
Pfam:Acetyltransf_10 428 537 6.3e-12 PFAM
Pfam:Acetyltransf_7 458 539 5.7e-12 PFAM
Pfam:Acetyltransf_1 464 538 3.1e-12 PFAM
Pfam:FR47 479 544 2.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156410
Meta Mutation Damage Score 0.4038 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 94% (31/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CSRP2 is a protein containing two LIM domains, which are double zinc finger motifs found in proteins of diverse function. CSRP2 and some related proteins are thought to act as protein adapters, bridging two or more proteins to form a larger protein complex. The protein encoded by this gene binds to one of the LIM domains of CSRP2 and contains an acetyltransferase domain. Although the encoded protein has been detected in the cytoplasm, it is predominantly a nuclear protein. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, decreased size, increased apoptosis, and disrupted cell cycling. Mice heterozygous for one targeted allele exhibit corneal opacity. [provided by MGI curators]
Allele List at MGI

All alleles(54) : Targeted, other(1) Gene trapped(53)

Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Casp6 A G 3: 129,913,344 H201R probably damaging Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Cdh16 A G 8: 104,617,730 L59P probably benign Het
Dcp2 T A 18: 44,395,967 Y50N probably damaging Het
Elk3 A G 10: 93,265,335 probably null Het
Fam78b T C 1: 167,001,732 V51A possibly damaging Het
Gabrb2 A T 11: 42,421,328 probably benign Het
Glyctk G T 9: 106,157,762 A35E probably benign Het
Kcng1 T A 2: 168,262,697 S410C probably damaging Het
Krt74 A G 15: 101,758,869 noncoding transcript Het
Lrp12 T C 15: 39,885,013 T70A probably damaging Het
Man2c1 A G 9: 57,138,026 D473G probably benign Het
Mindy4 G A 6: 55,224,346 G339S possibly damaging Het
Naip1 C T 13: 100,444,286 G151D probably benign Het
Ndufaf7 G A 17: 78,944,986 V275I probably benign Het
Nppb T A 4: 147,986,974 L121* probably null Het
Olfr111 T C 17: 37,530,006 S10P possibly damaging Het
Olfr1167 T C 2: 88,149,845 H58R probably damaging Het
Oog2 A T 4: 144,196,212 Q349L probably benign Het
Pcdhgb8 T G 18: 37,762,543 V222G possibly damaging Het
Plcd3 A T 11: 103,078,464 C226S probably damaging Het
Plxdc2 A G 2: 16,565,385 E125G probably damaging Het
Rnf213 A G 11: 119,441,243 E2426G probably damaging Het
Rraga T C 4: 86,576,067 V50A possibly damaging Het
Scmh1 T C 4: 120,529,276 probably benign Het
Slc9a9 A G 9: 95,228,899 Y590C probably damaging Het
Snx20 C T 8: 88,627,385 R239Q probably benign Het
Vmn2r59 A G 7: 42,021,308 probably benign Het
Zfp128 A G 7: 12,890,362 D219G probably benign Het
Other mutations in Kat14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Kat14 APN 2 144394255 missense probably benign 0.01
IGL01361:Kat14 APN 2 144406620 splice site probably null
IGL01958:Kat14 APN 2 144394365 missense probably damaging 1.00
IGL02499:Kat14 APN 2 144393831 missense probably benign 0.45
IGL02625:Kat14 APN 2 144402445 missense possibly damaging 0.79
IGL02814:Kat14 APN 2 144402463 missense probably benign
IGL02883:Kat14 APN 2 144393529 missense probably damaging 1.00
IGL03114:Kat14 APN 2 144375965 critical splice donor site probably null
A5278:Kat14 UTSW 2 144393307 nonsense probably null
R1446:Kat14 UTSW 2 144373718 missense probably damaging 1.00
R1517:Kat14 UTSW 2 144373791 missense probably benign 0.00
R1589:Kat14 UTSW 2 144394100 missense probably benign 0.06
R2071:Kat14 UTSW 2 144389216 missense probably damaging 1.00
R3911:Kat14 UTSW 2 144404062 missense probably damaging 1.00
R3951:Kat14 UTSW 2 144407329 utr 3 prime probably benign
R4624:Kat14 UTSW 2 144404220 intron probably benign
R4628:Kat14 UTSW 2 144404220 intron probably benign
R4629:Kat14 UTSW 2 144404220 intron probably benign
R4944:Kat14 UTSW 2 144375953 missense probably damaging 0.99
R5401:Kat14 UTSW 2 144389260 missense possibly damaging 0.77
R5429:Kat14 UTSW 2 144393323 missense probably benign 0.03
R7165:Kat14 UTSW 2 144393998 missense probably benign 0.03
R7453:Kat14 UTSW 2 144380734 missense possibly damaging 0.85
R7738:Kat14 UTSW 2 144394242 missense probably damaging 1.00
R9130:Kat14 UTSW 2 144373822 missense probably benign 0.30
R9260:Kat14 UTSW 2 144393521 missense probably benign 0.02
X0018:Kat14 UTSW 2 144373857 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGAAAGAAGGTCCGAGCTCC -3'
(R):5'- GGAAGCTCCTCCATCTTTGG -3'

Sequencing Primer
(F):5'- CGAGCTCCGGAACAGATAAAACAG -3'
(R):5'- TGGCTCCATAAATCCCATCG -3'
Posted On 2015-06-12