Incidental Mutation 'R4167:Cdh16'
ID 320624
Institutional Source Beutler Lab
Gene Symbol Cdh16
Ensembl Gene ENSMUSG00000031881
Gene Name cadherin 16
Synonyms KSP-cadherin
MMRRC Submission 041008-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R4167 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 105328547-105351028 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105344362 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 59 (L59P)
Ref Sequence ENSEMBL: ENSMUSP00000148701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163783] [ENSMUST00000211849] [ENSMUST00000211903] [ENSMUST00000212045] [ENSMUST00000212324] [ENSMUST00000212882] [ENSMUST00000212420] [ENSMUST00000213033] [ENSMUST00000212447] [ENSMUST00000212748] [ENSMUST00000212662]
AlphaFold O88338
Predicted Effect probably benign
Transcript: ENSMUST00000163783
AA Change: L534P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129663
Gene: ENSMUSG00000031881
AA Change: L534P

DomainStartEndE-ValueType
CA 47 126 2.42e-9 SMART
CA 150 243 3.93e-9 SMART
CA 260 336 5.52e-13 SMART
CA 360 449 1.33e-15 SMART
CA 474 563 3.35e-1 SMART
CA 585 663 7.88e-1 SMART
transmembrane domain 788 810 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211849
Predicted Effect probably benign
Transcript: ENSMUST00000211889
Predicted Effect probably benign
Transcript: ENSMUST00000211903
AA Change: L564P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000212045
Predicted Effect probably benign
Transcript: ENSMUST00000212318
Predicted Effect probably benign
Transcript: ENSMUST00000212324
Predicted Effect probably benign
Transcript: ENSMUST00000212882
AA Change: L564P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000212420
AA Change: L105P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000213033
AA Change: L59P

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000212447
Predicted Effect probably benign
Transcript: ENSMUST00000212748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212689
Predicted Effect probably benign
Transcript: ENSMUST00000212662
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 94% (31/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. Mapped to a previously identified cluster of cadherin genes on chromosome 16q22.1, the gene localizes with superfamily members CDH1, CDH3, CDH5, CDH8 and CDH11. The protein consists of an extracellular domain containing 6 cadherin domains, a transmembrane region and a truncated cytoplasmic domain but lacks the prosequence and tripeptide HAV adhesion recognition sequence typical of most classical cadherins. Expression is exclusively in kidney, where the protein functions as the principal mediator of homotypic cellular recognition, playing a role in the morphogenic direction of tissue development. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Casp6 A G 3: 129,706,993 (GRCm39) H201R probably damaging Het
Cd200r3 T A 16: 44,774,552 (GRCm39) D188E probably benign Het
Dcp2 T A 18: 44,529,034 (GRCm39) Y50N probably damaging Het
Elk3 A G 10: 93,101,197 (GRCm39) probably null Het
Fam78b T C 1: 166,829,301 (GRCm39) V51A possibly damaging Het
Gabrb2 A T 11: 42,312,155 (GRCm39) probably benign Het
Glyctk G T 9: 106,034,961 (GRCm39) A35E probably benign Het
Kat14 A G 2: 144,236,030 (GRCm39) E254G probably damaging Het
Kcng1 T A 2: 168,104,617 (GRCm39) S410C probably damaging Het
Krt74 A G 15: 101,667,304 (GRCm39) noncoding transcript Het
Lrp12 T C 15: 39,748,409 (GRCm39) T70A probably damaging Het
Man2c1 A G 9: 57,045,310 (GRCm39) D473G probably benign Het
Mindy4 G A 6: 55,201,331 (GRCm39) G339S possibly damaging Het
Naip1 C T 13: 100,580,794 (GRCm39) G151D probably benign Het
Ndufaf7 G A 17: 79,252,415 (GRCm39) V275I probably benign Het
Nppb T A 4: 148,071,431 (GRCm39) L121* probably null Het
Oog2 A T 4: 143,922,782 (GRCm39) Q349L probably benign Het
Or5d39 T C 2: 87,980,189 (GRCm39) H58R probably damaging Het
Or5v1b T C 17: 37,840,897 (GRCm39) S10P possibly damaging Het
Pcdhgb8 T G 18: 37,895,596 (GRCm39) V222G possibly damaging Het
Plcd3 A T 11: 102,969,290 (GRCm39) C226S probably damaging Het
Plxdc2 A G 2: 16,570,196 (GRCm39) E125G probably damaging Het
Rnf213 A G 11: 119,332,069 (GRCm39) E2426G probably damaging Het
Rraga T C 4: 86,494,304 (GRCm39) V50A possibly damaging Het
Scmh1 T C 4: 120,386,473 (GRCm39) probably benign Het
Slc9a9 A G 9: 95,110,952 (GRCm39) Y590C probably damaging Het
Snx20 C T 8: 89,354,013 (GRCm39) R239Q probably benign Het
Vmn2r59 A G 7: 41,670,732 (GRCm39) probably benign Het
Zfp128 A G 7: 12,624,289 (GRCm39) D219G probably benign Het
Other mutations in Cdh16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Cdh16 APN 8 105,350,045 (GRCm39) missense probably benign 0.00
IGL01406:Cdh16 APN 8 105,345,044 (GRCm39) missense possibly damaging 0.93
IGL01477:Cdh16 APN 8 105,345,140 (GRCm39) missense probably damaging 0.97
IGL01478:Cdh16 APN 8 105,341,120 (GRCm39) splice site probably benign
IGL01783:Cdh16 APN 8 105,344,488 (GRCm39) missense probably damaging 1.00
IGL01951:Cdh16 APN 8 105,344,323 (GRCm39) missense probably damaging 0.99
IGL02390:Cdh16 APN 8 105,348,606 (GRCm39) missense probably damaging 1.00
IGL02646:Cdh16 APN 8 105,348,737 (GRCm39) critical splice acceptor site probably null
IGL02938:Cdh16 APN 8 105,343,561 (GRCm39) intron probably benign
IGL02961:Cdh16 APN 8 105,341,837 (GRCm39) missense probably damaging 1.00
IGL03378:Cdh16 APN 8 105,345,917 (GRCm39) missense probably benign 0.09
PIT1430001:Cdh16 UTSW 8 105,344,271 (GRCm39) missense probably benign 0.05
R0016:Cdh16 UTSW 8 105,344,264 (GRCm39) missense probably benign 0.22
R1233:Cdh16 UTSW 8 105,345,114 (GRCm39) missense possibly damaging 0.89
R1470:Cdh16 UTSW 8 105,345,003 (GRCm39) missense probably benign 0.04
R1470:Cdh16 UTSW 8 105,345,003 (GRCm39) missense probably benign 0.04
R1490:Cdh16 UTSW 8 105,348,702 (GRCm39) missense probably damaging 1.00
R1752:Cdh16 UTSW 8 105,346,505 (GRCm39) critical splice donor site probably null
R1892:Cdh16 UTSW 8 105,344,631 (GRCm39) missense possibly damaging 0.69
R1913:Cdh16 UTSW 8 105,343,100 (GRCm39) missense probably benign 0.11
R1933:Cdh16 UTSW 8 105,344,595 (GRCm39) missense possibly damaging 0.71
R1934:Cdh16 UTSW 8 105,344,595 (GRCm39) missense possibly damaging 0.71
R2029:Cdh16 UTSW 8 105,344,434 (GRCm39) missense probably damaging 1.00
R2057:Cdh16 UTSW 8 105,348,597 (GRCm39) nonsense probably null
R2337:Cdh16 UTSW 8 105,348,902 (GRCm39) missense probably benign 0.09
R3848:Cdh16 UTSW 8 105,344,473 (GRCm39) missense possibly damaging 0.64
R3850:Cdh16 UTSW 8 105,344,473 (GRCm39) missense possibly damaging 0.64
R3892:Cdh16 UTSW 8 105,342,959 (GRCm39) missense probably damaging 1.00
R4577:Cdh16 UTSW 8 105,345,191 (GRCm39) missense probably damaging 1.00
R4657:Cdh16 UTSW 8 105,341,858 (GRCm39) splice site probably null
R4726:Cdh16 UTSW 8 105,342,664 (GRCm39) missense probably damaging 0.97
R4843:Cdh16 UTSW 8 105,348,172 (GRCm39) missense probably damaging 1.00
R4878:Cdh16 UTSW 8 105,344,696 (GRCm39) missense probably damaging 1.00
R5013:Cdh16 UTSW 8 105,343,660 (GRCm39) missense probably damaging 1.00
R5642:Cdh16 UTSW 8 105,344,677 (GRCm39) missense probably damaging 0.98
R6134:Cdh16 UTSW 8 105,342,697 (GRCm39) missense probably benign 0.15
R6311:Cdh16 UTSW 8 105,341,065 (GRCm39) missense probably benign 0.40
R6352:Cdh16 UTSW 8 105,343,624 (GRCm39) missense probably damaging 0.99
R6382:Cdh16 UTSW 8 105,348,175 (GRCm39) missense possibly damaging 0.78
R6713:Cdh16 UTSW 8 105,346,617 (GRCm39) nonsense probably null
R6732:Cdh16 UTSW 8 105,345,165 (GRCm39) missense probably benign 0.28
R6755:Cdh16 UTSW 8 105,345,880 (GRCm39) missense probably damaging 1.00
R6913:Cdh16 UTSW 8 105,348,896 (GRCm39) missense probably benign 0.00
R7037:Cdh16 UTSW 8 105,344,267 (GRCm39) nonsense probably null
R7202:Cdh16 UTSW 8 105,340,780 (GRCm39) missense unknown
R7413:Cdh16 UTSW 8 105,346,572 (GRCm39) missense probably benign 0.00
R7460:Cdh16 UTSW 8 105,348,923 (GRCm39) missense possibly damaging 0.88
R8017:Cdh16 UTSW 8 105,342,899 (GRCm39) missense probably damaging 1.00
R8187:Cdh16 UTSW 8 105,344,870 (GRCm39) missense probably damaging 1.00
R8261:Cdh16 UTSW 8 105,341,811 (GRCm39) nonsense probably null
R8278:Cdh16 UTSW 8 105,345,107 (GRCm39) missense probably benign 0.39
R8421:Cdh16 UTSW 8 105,348,602 (GRCm39) missense probably benign 0.00
R8491:Cdh16 UTSW 8 105,343,681 (GRCm39) missense probably damaging 1.00
R8725:Cdh16 UTSW 8 105,344,874 (GRCm39) missense probably benign 0.00
R8810:Cdh16 UTSW 8 105,341,136 (GRCm39) missense probably damaging 0.97
R9246:Cdh16 UTSW 8 105,344,602 (GRCm39) missense probably benign
R9267:Cdh16 UTSW 8 105,341,834 (GRCm39) missense probably damaging 1.00
R9661:Cdh16 UTSW 8 105,345,612 (GRCm39) missense probably benign 0.41
R9689:Cdh16 UTSW 8 105,341,108 (GRCm39) missense probably benign
RF005:Cdh16 UTSW 8 105,343,684 (GRCm39) missense probably damaging 1.00
RF024:Cdh16 UTSW 8 105,343,684 (GRCm39) missense probably damaging 1.00
X0067:Cdh16 UTSW 8 105,346,649 (GRCm39) missense probably damaging 1.00
Z1176:Cdh16 UTSW 8 105,341,817 (GRCm39) missense probably damaging 1.00
Z1177:Cdh16 UTSW 8 105,350,072 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGCCACATACGAAATGAGTTTCTC -3'
(R):5'- AAGGGTCACAAGTATACCGTGAC -3'

Sequencing Primer
(F):5'- CACATACGAAATGAGTTTCTCTGTGG -3'
(R):5'- TCACAAGTATACCGTGACCCACAC -3'
Posted On 2015-06-12