Incidental Mutation 'R4167:Slc9a9'
ID320626
Institutional Source Beutler Lab
Gene Symbol Slc9a9
Ensembl Gene ENSMUSG00000031129
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 9
Synonyms5730527A11Rik, Nhe9
MMRRC Submission 041008-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4167 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location94669909-95230445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95228899 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 590 (Y590C)
Ref Sequence ENSEMBL: ENSMUSP00000033463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033463]
Predicted Effect probably damaging
Transcript: ENSMUST00000033463
AA Change: Y590C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033463
Gene: ENSMUSG00000031129
AA Change: Y590C

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 28 486 2.6e-89 PFAM
low complexity region 594 600 N/A INTRINSIC
low complexity region 621 635 N/A INTRINSIC
Meta Mutation Damage Score 0.1887 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 94% (31/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium/proton exchanger that is a member of the solute carrier 9 protein family. The encoded protein localizes the to the late recycling endosomes and may play an important role in maintaining cation homeostasis. Mutations in this gene are associated with autism susceptibility 16 and attention-deficit/hyperactivity disorder. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Casp6 A G 3: 129,913,344 H201R probably damaging Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Cdh16 A G 8: 104,617,730 L59P probably benign Het
Dcp2 T A 18: 44,395,967 Y50N probably damaging Het
Elk3 A G 10: 93,265,335 probably null Het
Fam78b T C 1: 167,001,732 V51A possibly damaging Het
Gabrb2 A T 11: 42,421,328 probably benign Het
Glyctk G T 9: 106,157,762 A35E probably benign Het
Kat14 A G 2: 144,394,110 E254G probably damaging Het
Kcng1 T A 2: 168,262,697 S410C probably damaging Het
Krt74 A G 15: 101,758,869 noncoding transcript Het
Lrp12 T C 15: 39,885,013 T70A probably damaging Het
Man2c1 A G 9: 57,138,026 D473G probably benign Het
Mindy4 G A 6: 55,224,346 G339S possibly damaging Het
Naip1 C T 13: 100,444,286 G151D probably benign Het
Ndufaf7 G A 17: 78,944,986 V275I probably benign Het
Nppb T A 4: 147,986,974 L121* probably null Het
Olfr111 T C 17: 37,530,006 S10P possibly damaging Het
Olfr1167 T C 2: 88,149,845 H58R probably damaging Het
Oog2 A T 4: 144,196,212 Q349L probably benign Het
Pcdhgb8 T G 18: 37,762,543 V222G possibly damaging Het
Plcd3 A T 11: 103,078,464 C226S probably damaging Het
Plxdc2 A G 2: 16,565,385 E125G probably damaging Het
Rnf213 A G 11: 119,441,243 E2426G probably damaging Het
Rraga T C 4: 86,576,067 V50A possibly damaging Het
Scmh1 T C 4: 120,529,276 probably benign Het
Snx20 C T 8: 88,627,385 R239Q probably benign Het
Vmn2r59 A G 7: 42,021,308 probably benign Het
Zfp128 A G 7: 12,890,362 D219G probably benign Het
Other mutations in Slc9a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Slc9a9 APN 9 95055459 missense probably benign 0.03
IGL01394:Slc9a9 APN 9 95123037 missense probably benign
IGL01434:Slc9a9 APN 9 95019194 missense possibly damaging 0.49
IGL01715:Slc9a9 APN 9 94960446 missense probably damaging 1.00
IGL01821:Slc9a9 APN 9 95228950 missense probably benign
IGL02963:Slc9a9 APN 9 95020714 critical splice donor site probably null
IGL03211:Slc9a9 APN 9 95137990 splice site probably benign
ANU18:Slc9a9 UTSW 9 95055459 missense probably benign 0.03
R0306:Slc9a9 UTSW 9 95137934 missense probably benign
R0382:Slc9a9 UTSW 9 94685217 missense probably benign 0.18
R0388:Slc9a9 UTSW 9 94939563 critical splice donor site probably null
R1509:Slc9a9 UTSW 9 95228958 missense probably benign
R1785:Slc9a9 UTSW 9 95019193 missense possibly damaging 0.95
R4018:Slc9a9 UTSW 9 94685163 missense probably benign 0.03
R4170:Slc9a9 UTSW 9 95228899 missense probably damaging 0.98
R4695:Slc9a9 UTSW 9 94936449 critical splice donor site probably benign
R5400:Slc9a9 UTSW 9 94712901 missense probably damaging 1.00
R5609:Slc9a9 UTSW 9 94809937 missense probably damaging 1.00
R5684:Slc9a9 UTSW 9 95055508 missense possibly damaging 0.89
R6015:Slc9a9 UTSW 9 94939549 missense probably benign 0.29
R6102:Slc9a9 UTSW 9 94936429 missense probably benign 0.03
R6317:Slc9a9 UTSW 9 94939459 missense possibly damaging 0.51
R6398:Slc9a9 UTSW 9 94670227 missense probably benign 0.00
R6476:Slc9a9 UTSW 9 94685138 missense probably benign 0.00
R6501:Slc9a9 UTSW 9 94936371 missense probably benign 0.01
R6603:Slc9a9 UTSW 9 94939546 missense probably damaging 0.98
R6611:Slc9a9 UTSW 9 94939478 missense probably benign 0.18
R6700:Slc9a9 UTSW 9 94936311 missense possibly damaging 0.66
R6824:Slc9a9 UTSW 9 95227198 missense probably damaging 1.00
R6931:Slc9a9 UTSW 9 94670086 missense possibly damaging 0.73
R6975:Slc9a9 UTSW 9 94960446 missense probably damaging 1.00
R6987:Slc9a9 UTSW 9 94669990 start gained probably benign
R7325:Slc9a9 UTSW 9 94712898 missense probably benign 0.24
R7374:Slc9a9 UTSW 9 95055489 missense possibly damaging 0.90
R7437:Slc9a9 UTSW 9 95228941 missense probably benign 0.00
R7614:Slc9a9 UTSW 9 94855739 missense probably damaging 1.00
R8412:Slc9a9 UTSW 9 95229039 missense probably damaging 1.00
R8501:Slc9a9 UTSW 9 94855739 missense probably damaging 1.00
R8514:Slc9a9 UTSW 9 94936365 missense probably benign 0.01
X0010:Slc9a9 UTSW 9 94685208 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- ATGTATGTCTGTGTGCCATATACAC -3'
(R):5'- GGCATTCCTCAGTGGTCTTG -3'

Sequencing Primer
(F):5'- TGTGCCATATACACAAAACATTCC -3'
(R):5'- GTGATTAAGTCTGCACTCATCATACC -3'
Posted On2015-06-12