Incidental Mutation 'R4167:Plcd3'
ID320630
Institutional Source Beutler Lab
Gene Symbol Plcd3
Ensembl Gene ENSMUSG00000020937
Gene Namephospholipase C, delta 3
Synonyms2610205J15Rik
MMRRC Submission 041008-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.669) question?
Stock #R4167 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location103070304-103101658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103078464 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 226 (C226S)
Ref Sequence ENSEMBL: ENSMUSP00000099366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103077]
Predicted Effect probably damaging
Transcript: ENSMUST00000103077
AA Change: C226S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099366
Gene: ENSMUSG00000020937
AA Change: C226S

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 23 38 N/A INTRINSIC
PH 61 170 4.07e-5 SMART
Pfam:EF-hand_10 197 246 1.8e-27 PFAM
Pfam:EF-hand_like 251 332 2.6e-24 PFAM
PLCXc 333 478 7.75e-85 SMART
low complexity region 495 512 N/A INTRINSIC
PLCYc 524 640 3.96e-50 SMART
C2 657 763 1.05e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128650
SMART Domains Protein: ENSMUSP00000117455
Gene: ENSMUSG00000020937

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
PLCXc 19 164 7.75e-85 SMART
coiled coil region 172 206 N/A INTRINSIC
PLCYc 210 326 3.96e-50 SMART
C2 343 449 1.05e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181125
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 94% (31/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phospholipase C family, which catalyze the hydrolysis of phosphatidylinositol 4,5-bisphosphate to generate the second messengers diacylglycerol and inositol 1,4,5-trisphosphate (IP3). Diacylglycerol and IP3 mediate a variety of cellular responses to extracellular stimuli by inducing protein kinase C and increasing cytosolic Ca(2+) concentrations. This enzyme localizes to the plasma membrane and requires calcium for activation. Its activity is inhibited by spermine, sphingosine, and several phospholipids. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Casp6 A G 3: 129,913,344 H201R probably damaging Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Cdh16 A G 8: 104,617,730 L59P probably benign Het
Dcp2 T A 18: 44,395,967 Y50N probably damaging Het
Elk3 A G 10: 93,265,335 probably null Het
Fam78b T C 1: 167,001,732 V51A possibly damaging Het
Gabrb2 A T 11: 42,421,328 probably benign Het
Glyctk G T 9: 106,157,762 A35E probably benign Het
Kat14 A G 2: 144,394,110 E254G probably damaging Het
Kcng1 T A 2: 168,262,697 S410C probably damaging Het
Krt74 A G 15: 101,758,869 noncoding transcript Het
Lrp12 T C 15: 39,885,013 T70A probably damaging Het
Man2c1 A G 9: 57,138,026 D473G probably benign Het
Mindy4 G A 6: 55,224,346 G339S possibly damaging Het
Naip1 C T 13: 100,444,286 G151D probably benign Het
Ndufaf7 G A 17: 78,944,986 V275I probably benign Het
Nppb T A 4: 147,986,974 L121* probably null Het
Olfr111 T C 17: 37,530,006 S10P possibly damaging Het
Olfr1167 T C 2: 88,149,845 H58R probably damaging Het
Oog2 A T 4: 144,196,212 Q349L probably benign Het
Pcdhgb8 T G 18: 37,762,543 V222G possibly damaging Het
Plxdc2 A G 2: 16,565,385 E125G probably damaging Het
Rnf213 A G 11: 119,441,243 E2426G probably damaging Het
Rraga T C 4: 86,576,067 V50A possibly damaging Het
Scmh1 T C 4: 120,529,276 probably benign Het
Slc9a9 A G 9: 95,228,899 Y590C probably damaging Het
Snx20 C T 8: 88,627,385 R239Q probably benign Het
Vmn2r59 A G 7: 42,021,308 probably benign Het
Zfp128 A G 7: 12,890,362 D219G probably benign Het
Other mutations in Plcd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Plcd3 APN 11 103077870 missense probably benign 0.16
IGL01906:Plcd3 APN 11 103076856 missense probably damaging 1.00
IGL02325:Plcd3 APN 11 103080621 nonsense probably null
IGL02634:Plcd3 APN 11 103077827 missense probably damaging 1.00
IGL02852:Plcd3 APN 11 103073805 missense probably damaging 1.00
IGL03025:Plcd3 APN 11 103074898 missense probably benign 0.24
IGL02837:Plcd3 UTSW 11 103071103 missense possibly damaging 0.92
IGL02988:Plcd3 UTSW 11 103076742 missense probably benign
R0055:Plcd3 UTSW 11 103077585 missense probably damaging 1.00
R0055:Plcd3 UTSW 11 103077585 missense probably damaging 1.00
R0062:Plcd3 UTSW 11 103074894 missense probably benign
R0452:Plcd3 UTSW 11 103071259 unclassified probably benign
R0529:Plcd3 UTSW 11 103080187 missense probably benign 0.00
R0556:Plcd3 UTSW 11 103077806 missense probably damaging 1.00
R1463:Plcd3 UTSW 11 103078373 missense probably damaging 1.00
R1752:Plcd3 UTSW 11 103080259 missense probably benign 0.01
R2157:Plcd3 UTSW 11 103071148 missense probably benign
R2519:Plcd3 UTSW 11 103080400 missense possibly damaging 0.80
R3809:Plcd3 UTSW 11 103101383 missense probably null 0.03
R5100:Plcd3 UTSW 11 103078349 missense probably benign
R5387:Plcd3 UTSW 11 103078455 missense probably damaging 1.00
R5589:Plcd3 UTSW 11 103077803 missense probably benign 0.01
R5700:Plcd3 UTSW 11 103073763 missense probably benign 0.00
R5754:Plcd3 UTSW 11 103073766 missense possibly damaging 0.67
R5936:Plcd3 UTSW 11 103078347 missense probably damaging 1.00
R6059:Plcd3 UTSW 11 103080401 missense possibly damaging 0.80
R6102:Plcd3 UTSW 11 103080644 missense probably damaging 0.99
R6480:Plcd3 UTSW 11 103074931 missense possibly damaging 0.79
R6481:Plcd3 UTSW 11 103077767 missense probably damaging 1.00
R6566:Plcd3 UTSW 11 103073800 missense probably damaging 1.00
R7098:Plcd3 UTSW 11 103077863 missense probably damaging 1.00
R7165:Plcd3 UTSW 11 103079613 missense probably damaging 1.00
R7392:Plcd3 UTSW 11 103101557 unclassified probably benign
R7484:Plcd3 UTSW 11 103071719 missense probably damaging 1.00
R7606:Plcd3 UTSW 11 103076857 missense probably damaging 1.00
R7777:Plcd3 UTSW 11 103074655 missense probably benign 0.33
R7857:Plcd3 UTSW 11 103077934 missense probably benign 0.12
R8349:Plcd3 UTSW 11 103074670 missense probably damaging 1.00
R8449:Plcd3 UTSW 11 103074670 missense probably damaging 1.00
X0023:Plcd3 UTSW 11 103080208 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTCTGGATAAGCTGCTGGG -3'
(R):5'- AATCCTGATCTTGATCCCTGGGAC -3'

Sequencing Primer
(F):5'- TAAGCTGCTGGGCACAGG -3'
(R):5'- TGGGACAGTTGAGGACTCC -3'
Posted On2015-06-12