Incidental Mutation 'R4167:Olfr111'
ID320637
Institutional Source Beutler Lab
Gene Symbol Olfr111
Ensembl Gene ENSMUSG00000090675
Gene Nameolfactory receptor 111
SynonymsMOR249-1P, GA_x6K02T2PSCP-1989071-1990024
MMRRC Submission 041008-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.727) question?
Stock #R4167 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37508030-37532449 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37530006 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 10 (S10P)
Ref Sequence ENSEMBL: ENSMUSP00000150806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097325] [ENSMUST00000214259] [ENSMUST00000215424]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097325
AA Change: S10P

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000094933
Gene: ENSMUSG00000090675
AA Change: S10P

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5.4e-54 PFAM
Pfam:7TM_GPCR_Srsx 35 302 1.5e-5 PFAM
Pfam:7tm_1 41 290 1.4e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214259
AA Change: S10P

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215424
AA Change: S10P

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 94% (31/33)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Casp6 A G 3: 129,913,344 H201R probably damaging Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Cdh16 A G 8: 104,617,730 L59P probably benign Het
Dcp2 T A 18: 44,395,967 Y50N probably damaging Het
Elk3 A G 10: 93,265,335 probably null Het
Fam78b T C 1: 167,001,732 V51A possibly damaging Het
Gabrb2 A T 11: 42,421,328 probably benign Het
Glyctk G T 9: 106,157,762 A35E probably benign Het
Kat14 A G 2: 144,394,110 E254G probably damaging Het
Kcng1 T A 2: 168,262,697 S410C probably damaging Het
Krt74 A G 15: 101,758,869 noncoding transcript Het
Lrp12 T C 15: 39,885,013 T70A probably damaging Het
Man2c1 A G 9: 57,138,026 D473G probably benign Het
Mindy4 G A 6: 55,224,346 G339S possibly damaging Het
Naip1 C T 13: 100,444,286 G151D probably benign Het
Ndufaf7 G A 17: 78,944,986 V275I probably benign Het
Nppb T A 4: 147,986,974 L121* probably null Het
Olfr1167 T C 2: 88,149,845 H58R probably damaging Het
Oog2 A T 4: 144,196,212 Q349L probably benign Het
Pcdhgb8 T G 18: 37,762,543 V222G possibly damaging Het
Plcd3 A T 11: 103,078,464 C226S probably damaging Het
Plxdc2 A G 2: 16,565,385 E125G probably damaging Het
Rnf213 A G 11: 119,441,243 E2426G probably damaging Het
Rraga T C 4: 86,576,067 V50A possibly damaging Het
Scmh1 T C 4: 120,529,276 probably benign Het
Slc9a9 A G 9: 95,228,899 Y590C probably damaging Het
Snx20 C T 8: 88,627,385 R239Q probably benign Het
Vmn2r59 A G 7: 42,021,308 probably benign Het
Zfp128 A G 7: 12,890,362 D219G probably benign Het
Other mutations in Olfr111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01870:Olfr111 APN 17 37530664 missense probably benign 0.00
IGL02472:Olfr111 APN 17 37530749 missense probably damaging 1.00
IGL02511:Olfr111 APN 17 37529979 start codon destroyed probably null 0.99
BB009:Olfr111 UTSW 17 37530184 missense probably benign 0.31
BB019:Olfr111 UTSW 17 37530184 missense probably benign 0.31
R0335:Olfr111 UTSW 17 37530642 missense probably benign 0.01
R2006:Olfr111 UTSW 17 37530706 missense probably damaging 1.00
R3757:Olfr111 UTSW 17 37530355 missense probably damaging 1.00
R4904:Olfr111 UTSW 17 37530631 missense probably damaging 1.00
R4952:Olfr111 UTSW 17 37530750 missense possibly damaging 0.48
R7366:Olfr111 UTSW 17 37530817 missense probably damaging 0.99
R7389:Olfr111 UTSW 17 37530657 missense possibly damaging 0.72
R7510:Olfr111 UTSW 17 37530589 missense probably damaging 0.98
R7932:Olfr111 UTSW 17 37530184 missense probably benign 0.31
R8080:Olfr111 UTSW 17 37530664 missense probably benign 0.00
R8326:Olfr111 UTSW 17 37530579 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TTGCAAAGAACTGCTTCATTCG -3'
(R):5'- TGACAGAAGATGCACCATCATC -3'

Sequencing Primer
(F):5'- CAAAGAACTGCTTCATTCGTGGTTC -3'
(R):5'- CCATCATCTGGGGGACATTAG -3'
Posted On2015-06-12