Incidental Mutation 'R4168:Zc2hc1a'
ID320646
Institutional Source Beutler Lab
Gene Symbol Zc2hc1a
Ensembl Gene ENSMUSG00000043542
Gene Namezinc finger, C2HC-type containing 1A
Synonyms3110050N22Rik, Fam164a
MMRRC Submission 041009-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R4168 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location7503483-7553836 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7518391 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 41 (T41A)
Ref Sequence ENSEMBL: ENSMUSP00000141497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051064] [ENSMUST00000193010]
Predicted Effect probably benign
Transcript: ENSMUST00000051064
AA Change: T41A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000054734
Gene: ENSMUSG00000043542
AA Change: T41A

DomainStartEndE-ValueType
Pfam:zf-C2HC_2 15 39 2.6e-11 PFAM
low complexity region 62 77 N/A INTRINSIC
Pfam:zf-C2HC_2 118 142 8.7e-8 PFAM
low complexity region 176 187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193010
AA Change: T41A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000141497
Gene: ENSMUSG00000043542
AA Change: T41A

DomainStartEndE-ValueType
Pfam:zf-C2HC_2 15 39 2.3e-11 PFAM
low complexity region 62 77 N/A INTRINSIC
Pfam:zf-C2HC_2 118 142 1.2e-7 PFAM
low complexity region 176 187 N/A INTRINSIC
Meta Mutation Damage Score 0.0759 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,137,109 L151P probably benign Het
C3 A T 17: 57,218,608 F883I probably benign Het
Cbr4 T A 8: 61,491,521 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Chpf2 T C 5: 24,591,790 V578A possibly damaging Het
Clasrp A G 7: 19,581,154 probably benign Het
Cmip A T 8: 117,456,917 N743I probably damaging Het
Ctif A C 18: 75,637,215 L33R probably damaging Het
Dmap1 T A 4: 117,681,310 H54L possibly damaging Het
Elk3 A G 10: 93,265,335 probably null Het
Flt4 G A 11: 49,630,573 R440H probably benign Het
Gabrb2 A T 11: 42,421,328 probably benign Het
Gm12789 A G 4: 101,989,962 Y148C possibly damaging Het
Gm5724 T C 6: 141,738,947 I261V probably benign Het
Haspin A G 11: 73,136,022 L747P probably damaging Het
Intu C T 3: 40,672,623 P278L probably benign Het
Kif27 A G 13: 58,345,748 I127T probably benign Het
Mogat1 T C 1: 78,512,035 V25A possibly damaging Het
Nop14 A G 5: 34,656,744 S157P probably damaging Het
Olfr1040 A G 2: 86,146,179 I185T probably benign Het
Olfr1167 T C 2: 88,149,845 H58R probably damaging Het
Olfr195 A T 16: 59,149,000 Y50F probably benign Het
Oxct2b T C 4: 123,117,685 L466P probably damaging Het
Padi6 A G 4: 140,741,934 C32R probably damaging Het
Pla2r1 A T 2: 60,497,614 Y501* probably null Het
Rb1cc1 G A 1: 6,230,024 V8I probably damaging Het
Rexo5 A G 7: 119,827,398 probably benign Het
Tmem119 T C 5: 113,794,987 E251G probably benign Het
Vmn2r112 T A 17: 22,603,088 M249K probably benign Het
Zfp128 A G 7: 12,890,362 D219G probably benign Het
Znrf2 T C 6: 54,863,960 V173A possibly damaging Het
Other mutations in Zc2hc1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02395:Zc2hc1a APN 3 7528624 nonsense probably null
IGL03071:Zc2hc1a APN 3 7524122 splice site probably benign
IGL03342:Zc2hc1a APN 3 7524223 missense possibly damaging 0.89
R0882:Zc2hc1a UTSW 3 7526362 missense possibly damaging 0.68
R1638:Zc2hc1a UTSW 3 7516483 missense probably benign 0.35
R2513:Zc2hc1a UTSW 3 7516536 splice site probably null
R5322:Zc2hc1a UTSW 3 7551421 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATAATTTCCTGAAAGGTAGGTGTGG -3'
(R):5'- CACGGAATTTTGTTTACCTAGACTC -3'

Sequencing Primer
(F):5'- GGCAGTGTACATGTTTTGAAGC -3'
(R):5'- GACCGTGGGAATATCAGT -3'
Posted On2015-06-12