Incidental Mutation 'R4168:Oxct2b'
ID320650
Institutional Source Beutler Lab
Gene Symbol Oxct2b
Ensembl Gene ENSMUSG00000076438
Gene Name3-oxoacid CoA transferase 2B
SynonymsScot-t2
MMRRC Submission 041009-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R4168 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location123116266-123118000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123117685 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 466 (L466P)
Ref Sequence ENSEMBL: ENSMUSP00000099708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002457] [ENSMUST00000102648]
Predicted Effect probably benign
Transcript: ENSMUST00000002457
SMART Domains Protein: ENSMUSP00000002457
Gene: ENSMUSG00000002384

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:TGFb_propeptide 26 248 2.7e-62 PFAM
TGFB 298 399 2.83e-59 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102648
AA Change: L466P

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099708
Gene: ENSMUSG00000076438
AA Change: L466P

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
CoA_trans 43 272 2.02e-79 SMART
CoA_trans 301 499 5.07e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194481
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,137,109 L151P probably benign Het
C3 A T 17: 57,218,608 F883I probably benign Het
Cbr4 T A 8: 61,491,521 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Chpf2 T C 5: 24,591,790 V578A possibly damaging Het
Clasrp A G 7: 19,581,154 probably benign Het
Cmip A T 8: 117,456,917 N743I probably damaging Het
Ctif A C 18: 75,637,215 L33R probably damaging Het
Dmap1 T A 4: 117,681,310 H54L possibly damaging Het
Elk3 A G 10: 93,265,335 probably null Het
Flt4 G A 11: 49,630,573 R440H probably benign Het
Gabrb2 A T 11: 42,421,328 probably benign Het
Gm12789 A G 4: 101,989,962 Y148C possibly damaging Het
Gm5724 T C 6: 141,738,947 I261V probably benign Het
Haspin A G 11: 73,136,022 L747P probably damaging Het
Intu C T 3: 40,672,623 P278L probably benign Het
Kif27 A G 13: 58,345,748 I127T probably benign Het
Mogat1 T C 1: 78,512,035 V25A possibly damaging Het
Nop14 A G 5: 34,656,744 S157P probably damaging Het
Olfr1040 A G 2: 86,146,179 I185T probably benign Het
Olfr1167 T C 2: 88,149,845 H58R probably damaging Het
Olfr195 A T 16: 59,149,000 Y50F probably benign Het
Padi6 A G 4: 140,741,934 C32R probably damaging Het
Pla2r1 A T 2: 60,497,614 Y501* probably null Het
Rb1cc1 G A 1: 6,230,024 V8I probably damaging Het
Rexo5 A G 7: 119,827,398 probably benign Het
Tmem119 T C 5: 113,794,987 E251G probably benign Het
Vmn2r112 T A 17: 22,603,088 M249K probably benign Het
Zc2hc1a A G 3: 7,518,391 T41A probably benign Het
Zfp128 A G 7: 12,890,362 D219G probably benign Het
Znrf2 T C 6: 54,863,960 V173A possibly damaging Het
Other mutations in Oxct2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Oxct2b APN 4 123117508 missense probably damaging 1.00
R0504:Oxct2b UTSW 4 123116840 missense possibly damaging 0.92
R0504:Oxct2b UTSW 4 123116912 small deletion probably benign
R0543:Oxct2b UTSW 4 123116989 missense possibly damaging 0.93
R1167:Oxct2b UTSW 4 123117585 missense probably damaging 0.99
R1365:Oxct2b UTSW 4 123117369 missense probably benign
R1891:Oxct2b UTSW 4 123117145 missense probably benign 0.01
R2311:Oxct2b UTSW 4 123117418 missense probably damaging 1.00
R2906:Oxct2b UTSW 4 123117030 missense probably benign 0.12
R4657:Oxct2b UTSW 4 123117133 missense probably damaging 1.00
R6159:Oxct2b UTSW 4 123117451 missense probably damaging 1.00
R6221:Oxct2b UTSW 4 123116808 missense probably damaging 1.00
R6271:Oxct2b UTSW 4 123117715 missense probably damaging 1.00
R6357:Oxct2b UTSW 4 123116916 missense probably benign 0.00
R6389:Oxct2b UTSW 4 123116574 missense probably benign 0.21
R6996:Oxct2b UTSW 4 123117687 missense probably benign 0.05
R7210:Oxct2b UTSW 4 123116276 start gained probably benign
R7655:Oxct2b UTSW 4 123117757 missense probably benign 0.16
R7656:Oxct2b UTSW 4 123117757 missense probably benign 0.16
R7849:Oxct2b UTSW 4 123116887 missense probably damaging 1.00
R7934:Oxct2b UTSW 4 123116654 nonsense probably null
R8094:Oxct2b UTSW 4 123116508 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TTGGGGCCATGCAAGTTTC -3'
(R):5'- CTGGAAAATCAGCCCTGGAG -3'

Sequencing Primer
(F):5'- GCAAGTTTCTCAATACGGCG -3'
(R):5'- GATGTCATCTACCGACGA -3'
Posted On2015-06-12