Incidental Mutation 'R4168:Znrf2'
ID320655
Institutional Source Beutler Lab
Gene Symbol Znrf2
Ensembl Gene ENSMUSG00000058446
Gene Namezinc and ring finger 2
SynonymsD6Ertd365e, 1190002C14Rik
MMRRC Submission 041009-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R4168 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location54816916-54893500 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54863960 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 173 (V173A)
Ref Sequence ENSEMBL: ENSMUSP00000078795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079869] [ENSMUST00000127331]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079869
AA Change: V173A

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078795
Gene: ENSMUSG00000058446
AA Change: V173A

DomainStartEndE-ValueType
low complexity region 18 71 N/A INTRINSIC
low complexity region 72 92 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
RING 195 235 9.83e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127331
AA Change: V29A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000123316
Gene: ENSMUSG00000058446
AA Change: V29A

DomainStartEndE-ValueType
RING 51 91 9.83e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148425
Meta Mutation Damage Score 0.0783 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,137,109 L151P probably benign Het
C3 A T 17: 57,218,608 F883I probably benign Het
Cbr4 T A 8: 61,491,521 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Chpf2 T C 5: 24,591,790 V578A possibly damaging Het
Clasrp A G 7: 19,581,154 probably benign Het
Cmip A T 8: 117,456,917 N743I probably damaging Het
Ctif A C 18: 75,637,215 L33R probably damaging Het
Dmap1 T A 4: 117,681,310 H54L possibly damaging Het
Elk3 A G 10: 93,265,335 probably null Het
Flt4 G A 11: 49,630,573 R440H probably benign Het
Gabrb2 A T 11: 42,421,328 probably benign Het
Gm12789 A G 4: 101,989,962 Y148C possibly damaging Het
Gm5724 T C 6: 141,738,947 I261V probably benign Het
Haspin A G 11: 73,136,022 L747P probably damaging Het
Intu C T 3: 40,672,623 P278L probably benign Het
Kif27 A G 13: 58,345,748 I127T probably benign Het
Mogat1 T C 1: 78,512,035 V25A possibly damaging Het
Nop14 A G 5: 34,656,744 S157P probably damaging Het
Olfr1040 A G 2: 86,146,179 I185T probably benign Het
Olfr1167 T C 2: 88,149,845 H58R probably damaging Het
Olfr195 A T 16: 59,149,000 Y50F probably benign Het
Oxct2b T C 4: 123,117,685 L466P probably damaging Het
Padi6 A G 4: 140,741,934 C32R probably damaging Het
Pla2r1 A T 2: 60,497,614 Y501* probably null Het
Rb1cc1 G A 1: 6,230,024 V8I probably damaging Het
Rexo5 A G 7: 119,827,398 probably benign Het
Tmem119 T C 5: 113,794,987 E251G probably benign Het
Vmn2r112 T A 17: 22,603,088 M249K probably benign Het
Zc2hc1a A G 3: 7,518,391 T41A probably benign Het
Zfp128 A G 7: 12,890,362 D219G probably benign Het
Other mutations in Znrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Znrf2 APN 6 54863972 missense probably damaging 1.00
IGL03243:Znrf2 APN 6 54884769 missense possibly damaging 0.95
R3406:Znrf2 UTSW 6 54884791 missense probably damaging 1.00
R4604:Znrf2 UTSW 6 54878440 nonsense probably null
R6575:Znrf2 UTSW 6 54878445 missense probably damaging 1.00
R7076:Znrf2 UTSW 6 54842695 makesense probably null
R7880:Znrf2 UTSW 6 54817347 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGAGTCATATGGGCTCTAGTCAC -3'
(R):5'- TCCAACAATCTAGAGTCAGGAGGTG -3'

Sequencing Primer
(F):5'- TTGGTCTAATGCGCCTT -3'
(R):5'- TACCTCTGTAGACCCAGGATG -3'
Posted On2015-06-12