Incidental Mutation 'R4168:Rexo5'
ID320660
Institutional Source Beutler Lab
Gene Symbol Rexo5
Ensembl Gene ENSMUSG00000030924
Gene NameRNA exonuclease 5
Synonyms2610020H08Rik
MMRRC Submission 041009-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R4168 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location119794006-119848943 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 119827398 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000033218] [ENSMUST00000084644] [ENSMUST00000106520] [ENSMUST00000133758]
Predicted Effect probably benign
Transcript: ENSMUST00000033218
SMART Domains Protein: ENSMUSP00000033218
Gene: ENSMUSG00000030924

DomainStartEndE-ValueType
low complexity region 105 116 N/A INTRINSIC
low complexity region 123 134 N/A INTRINSIC
Pfam:RNase_T 225 330 1.4e-12 PFAM
Blast:RRM 424 463 5e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000084644
SMART Domains Protein: ENSMUSP00000081694
Gene: ENSMUSG00000030924

DomainStartEndE-ValueType
EXOIII 31 189 2.72e-29 SMART
RRM 298 367 3.23e-9 SMART
Blast:RRM 393 437 2e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106520
SMART Domains Protein: ENSMUSP00000102130
Gene: ENSMUSG00000030924

DomainStartEndE-ValueType
low complexity region 105 116 N/A INTRINSIC
low complexity region 123 134 N/A INTRINSIC
EXOIII 223 381 2.72e-29 SMART
RRM 491 560 3.23e-9 SMART
RRM 586 661 3.28e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155938
Predicted Effect probably benign
Transcript: ENSMUST00000207042
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (39/40)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,137,109 L151P probably benign Het
C3 A T 17: 57,218,608 F883I probably benign Het
Cbr4 T A 8: 61,491,521 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Chpf2 T C 5: 24,591,790 V578A possibly damaging Het
Clasrp A G 7: 19,581,154 probably benign Het
Cmip A T 8: 117,456,917 N743I probably damaging Het
Ctif A C 18: 75,637,215 L33R probably damaging Het
Dmap1 T A 4: 117,681,310 H54L possibly damaging Het
Elk3 A G 10: 93,265,335 probably null Het
Flt4 G A 11: 49,630,573 R440H probably benign Het
Gabrb2 A T 11: 42,421,328 probably benign Het
Gm12789 A G 4: 101,989,962 Y148C possibly damaging Het
Gm5724 T C 6: 141,738,947 I261V probably benign Het
Haspin A G 11: 73,136,022 L747P probably damaging Het
Intu C T 3: 40,672,623 P278L probably benign Het
Kif27 A G 13: 58,345,748 I127T probably benign Het
Mogat1 T C 1: 78,512,035 V25A possibly damaging Het
Nop14 A G 5: 34,656,744 S157P probably damaging Het
Olfr1040 A G 2: 86,146,179 I185T probably benign Het
Olfr1167 T C 2: 88,149,845 H58R probably damaging Het
Olfr195 A T 16: 59,149,000 Y50F probably benign Het
Oxct2b T C 4: 123,117,685 L466P probably damaging Het
Padi6 A G 4: 140,741,934 C32R probably damaging Het
Pla2r1 A T 2: 60,497,614 Y501* probably null Het
Rb1cc1 G A 1: 6,230,024 V8I probably damaging Het
Tmem119 T C 5: 113,794,987 E251G probably benign Het
Vmn2r112 T A 17: 22,603,088 M249K probably benign Het
Zc2hc1a A G 3: 7,518,391 T41A probably benign Het
Zfp128 A G 7: 12,890,362 D219G probably benign Het
Znrf2 T C 6: 54,863,960 V173A possibly damaging Het
Other mutations in Rexo5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Rexo5 APN 7 119834276 missense probably damaging 1.00
R0347:Rexo5 UTSW 7 119823896 critical splice donor site probably null
R0442:Rexo5 UTSW 7 119843285 missense probably damaging 1.00
R0589:Rexo5 UTSW 7 119845383 missense probably benign 0.00
R0980:Rexo5 UTSW 7 119823812 missense probably damaging 1.00
R1465:Rexo5 UTSW 7 119801358 critical splice donor site probably null
R1465:Rexo5 UTSW 7 119801358 critical splice donor site probably null
R1505:Rexo5 UTSW 7 119799603 nonsense probably null
R1775:Rexo5 UTSW 7 119845411 missense probably benign 0.00
R1911:Rexo5 UTSW 7 119799644 missense probably damaging 1.00
R1996:Rexo5 UTSW 7 119823857 missense probably damaging 1.00
R4169:Rexo5 UTSW 7 119827398 intron probably benign
R4402:Rexo5 UTSW 7 119834376 missense possibly damaging 0.82
R4486:Rexo5 UTSW 7 119825577 missense probably benign 0.00
R4620:Rexo5 UTSW 7 119827303 missense probably benign 0.37
R4621:Rexo5 UTSW 7 119819499 missense probably benign 0.19
R4865:Rexo5 UTSW 7 119801330 nonsense probably null
R4884:Rexo5 UTSW 7 119825551 nonsense probably null
R5171:Rexo5 UTSW 7 119823779 missense probably damaging 1.00
R5209:Rexo5 UTSW 7 119834299 nonsense probably null
R5266:Rexo5 UTSW 7 119844437 missense probably benign 0.00
R5463:Rexo5 UTSW 7 119834303 missense probably damaging 1.00
R5579:Rexo5 UTSW 7 119834403 critical splice donor site probably null
R6163:Rexo5 UTSW 7 119805247 missense probably damaging 1.00
R6305:Rexo5 UTSW 7 119828125 missense probably damaging 1.00
R7144:Rexo5 UTSW 7 119805191 missense probably damaging 1.00
R7282:Rexo5 UTSW 7 119818413 missense probably damaging 0.97
R8143:Rexo5 UTSW 7 119834261 splice site probably null
R8379:Rexo5 UTSW 7 119834285 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGCCAGCGTGTACTTAAGGC -3'
(R):5'- TGGACAATGCATCAAAAGCTACAG -3'

Sequencing Primer
(F):5'- TGTACTTAAGGCAGTGGCATAGC -3'
(R):5'- TATATAAATCAGGCCGCCCTTGG -3'
Posted On2015-06-12