Incidental Mutation 'R4168:Cbr4'
ID320661
Institutional Source Beutler Lab
Gene Symbol Cbr4
Ensembl Gene ENSMUSG00000031641
Gene Namecarbonyl reductase 4
Synonyms
MMRRC Submission 041009-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.680) question?
Stock #R4168 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location61487734-61506694 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 61491521 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034058] [ENSMUST00000126575]
Predicted Effect probably benign
Transcript: ENSMUST00000034058
SMART Domains Protein: ENSMUSP00000034058
Gene: ENSMUSG00000031641

DomainStartEndE-ValueType
Pfam:adh_short 3 192 2.4e-54 PFAM
Pfam:KR 4 182 6.5e-18 PFAM
Pfam:adh_short_C2 9 233 4.4e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126575
SMART Domains Protein: ENSMUSP00000117069
Gene: ENSMUSG00000031641

DomainStartEndE-ValueType
Pfam:adh_short 3 108 9.4e-20 PFAM
Pfam:KR 4 92 3.1e-10 PFAM
Pfam:adh_short_C2 9 110 1.1e-8 PFAM
low complexity region 117 128 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156535
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,137,109 L151P probably benign Het
C3 A T 17: 57,218,608 F883I probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Chpf2 T C 5: 24,591,790 V578A possibly damaging Het
Clasrp A G 7: 19,581,154 probably benign Het
Cmip A T 8: 117,456,917 N743I probably damaging Het
Ctif A C 18: 75,637,215 L33R probably damaging Het
Dmap1 T A 4: 117,681,310 H54L possibly damaging Het
Elk3 A G 10: 93,265,335 probably null Het
Flt4 G A 11: 49,630,573 R440H probably benign Het
Gabrb2 A T 11: 42,421,328 probably benign Het
Gm12789 A G 4: 101,989,962 Y148C possibly damaging Het
Gm5724 T C 6: 141,738,947 I261V probably benign Het
Haspin A G 11: 73,136,022 L747P probably damaging Het
Intu C T 3: 40,672,623 P278L probably benign Het
Kif27 A G 13: 58,345,748 I127T probably benign Het
Mogat1 T C 1: 78,512,035 V25A possibly damaging Het
Nop14 A G 5: 34,656,744 S157P probably damaging Het
Olfr1040 A G 2: 86,146,179 I185T probably benign Het
Olfr1167 T C 2: 88,149,845 H58R probably damaging Het
Olfr195 A T 16: 59,149,000 Y50F probably benign Het
Oxct2b T C 4: 123,117,685 L466P probably damaging Het
Padi6 A G 4: 140,741,934 C32R probably damaging Het
Pla2r1 A T 2: 60,497,614 Y501* probably null Het
Rb1cc1 G A 1: 6,230,024 V8I probably damaging Het
Rexo5 A G 7: 119,827,398 probably benign Het
Tmem119 T C 5: 113,794,987 E251G probably benign Het
Vmn2r112 T A 17: 22,603,088 M249K probably benign Het
Zc2hc1a A G 3: 7,518,391 T41A probably benign Het
Zfp128 A G 7: 12,890,362 D219G probably benign Het
Znrf2 T C 6: 54,863,960 V173A possibly damaging Het
Other mutations in Cbr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Cbr4 APN 8 61503211 makesense probably null
R0498:Cbr4 UTSW 8 61495073 missense probably benign 0.00
R0637:Cbr4 UTSW 8 61490706 splice site probably benign
R1609:Cbr4 UTSW 8 61503158 missense probably damaging 1.00
R4709:Cbr4 UTSW 8 61490027 missense possibly damaging 0.66
R4802:Cbr4 UTSW 8 61490079 intron probably benign
R5049:Cbr4 UTSW 8 61495204 critical splice donor site probably null
R5876:Cbr4 UTSW 8 61490593 missense possibly damaging 0.78
R6020:Cbr4 UTSW 8 61487853 missense probably benign 0.44
R7818:Cbr4 UTSW 8 61487942 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCAAGTTCAAAATGGGACTGC -3'
(R):5'- TTACATGCAATGACTATAGCCCC -3'

Sequencing Primer
(F):5'- GACTGCCCAGCACTTAGC -3'
(R):5'- ATGACTATAGCCCCCGGAG -3'
Posted On2015-06-12