Incidental Mutation 'R4168:Cmip'
ID320662
Institutional Source Beutler Lab
Gene Symbol Cmip
Ensembl Gene ENSMUSG00000034390
Gene Namec-Maf inducing protein
Synonyms
MMRRC Submission 041009-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4168 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location117257064-117459430 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 117456917 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 743 (N743I)
Ref Sequence ENSEMBL: ENSMUSP00000130264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095172] [ENSMUST00000166750]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095172
AA Change: N655I

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000092795
Gene: ENSMUSG00000034390
AA Change: N655I

DomainStartEndE-ValueType
Blast:PH 13 70 5e-33 BLAST
low complexity region 71 79 N/A INTRINSIC
low complexity region 306 319 N/A INTRINSIC
SCOP:d1a9na_ 564 681 6e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166750
AA Change: N743I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130264
Gene: ENSMUSG00000034390
AA Change: N743I

DomainStartEndE-ValueType
PH 54 163 2.71e-1 SMART
low complexity region 394 407 N/A INTRINSIC
SCOP:d1a9na_ 652 769 6e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183794
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212884
Meta Mutation Damage Score 0.4935 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a c-Maf inducing protein that plays a role in T-cell signaling pathway. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,137,109 L151P probably benign Het
C3 A T 17: 57,218,608 F883I probably benign Het
Cbr4 T A 8: 61,491,521 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Chpf2 T C 5: 24,591,790 V578A possibly damaging Het
Clasrp A G 7: 19,581,154 probably benign Het
Ctif A C 18: 75,637,215 L33R probably damaging Het
Dmap1 T A 4: 117,681,310 H54L possibly damaging Het
Elk3 A G 10: 93,265,335 probably null Het
Flt4 G A 11: 49,630,573 R440H probably benign Het
Gabrb2 A T 11: 42,421,328 probably benign Het
Gm12789 A G 4: 101,989,962 Y148C possibly damaging Het
Gm5724 T C 6: 141,738,947 I261V probably benign Het
Haspin A G 11: 73,136,022 L747P probably damaging Het
Intu C T 3: 40,672,623 P278L probably benign Het
Kif27 A G 13: 58,345,748 I127T probably benign Het
Mogat1 T C 1: 78,512,035 V25A possibly damaging Het
Nop14 A G 5: 34,656,744 S157P probably damaging Het
Olfr1040 A G 2: 86,146,179 I185T probably benign Het
Olfr1167 T C 2: 88,149,845 H58R probably damaging Het
Olfr195 A T 16: 59,149,000 Y50F probably benign Het
Oxct2b T C 4: 123,117,685 L466P probably damaging Het
Padi6 A G 4: 140,741,934 C32R probably damaging Het
Pla2r1 A T 2: 60,497,614 Y501* probably null Het
Rb1cc1 G A 1: 6,230,024 V8I probably damaging Het
Rexo5 A G 7: 119,827,398 probably benign Het
Tmem119 T C 5: 113,794,987 E251G probably benign Het
Vmn2r112 T A 17: 22,603,088 M249K probably benign Het
Zc2hc1a A G 3: 7,518,391 T41A probably benign Het
Zfp128 A G 7: 12,890,362 D219G probably benign Het
Znrf2 T C 6: 54,863,960 V173A possibly damaging Het
Other mutations in Cmip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02043:Cmip APN 8 117445328 missense probably benign 0.29
IGL02126:Cmip APN 8 117449031 missense probably damaging 0.99
IGL02205:Cmip APN 8 117454975 missense probably damaging 1.00
IGL02352:Cmip APN 8 117411255 splice site probably benign
IGL02359:Cmip APN 8 117411255 splice site probably benign
IGL02558:Cmip APN 8 117449088 missense probably damaging 0.99
R0070:Cmip UTSW 8 117426554 missense probably damaging 0.99
R0335:Cmip UTSW 8 117445366 missense probably damaging 0.99
R1225:Cmip UTSW 8 117445371 missense probably damaging 0.98
R1561:Cmip UTSW 8 117453850 missense probably benign 0.41
R2508:Cmip UTSW 8 117436693 missense probably benign
R2885:Cmip UTSW 8 117384965 missense probably benign 0.01
R3415:Cmip UTSW 8 117349377 critical splice donor site probably null
R4024:Cmip UTSW 8 117447416 missense possibly damaging 0.79
R4169:Cmip UTSW 8 117456917 missense probably damaging 1.00
R4632:Cmip UTSW 8 117447411 missense possibly damaging 0.88
R4706:Cmip UTSW 8 117377154 missense probably damaging 0.99
R4924:Cmip UTSW 8 117257255 missense probably benign 0.00
R5380:Cmip UTSW 8 117422890 missense probably damaging 0.99
R5927:Cmip UTSW 8 117257309 missense possibly damaging 0.85
R6212:Cmip UTSW 8 117377156 missense probably damaging 1.00
R6310:Cmip UTSW 8 117429810 missense possibly damaging 0.63
R6747:Cmip UTSW 8 117436879 missense probably benign 0.02
R6881:Cmip UTSW 8 117436595 missense possibly damaging 0.77
R6968:Cmip UTSW 8 117377156 missense probably damaging 1.00
R7003:Cmip UTSW 8 117384988 missense probably benign 0.13
R7400:Cmip UTSW 8 117257405 splice site probably null
R7583:Cmip UTSW 8 117454952 missense probably damaging 0.96
R8367:Cmip UTSW 8 117436871 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GTTGGTCATGATGGCTGAAC -3'
(R):5'- AACCCTGGCTGGTTTTGTCAC -3'

Sequencing Primer
(F):5'- GGTCATGATGGCTGAACTCACAC -3'
(R):5'- GGCTGGTTTTGTCACCGACC -3'
Posted On2015-06-12