Incidental Mutation 'R4168:Gabrb2'
ID320665
Institutional Source Beutler Lab
Gene Symbol Gabrb2
Ensembl Gene ENSMUSG00000007653
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit beta 2
SynonymsC030002O17Rik, C030021G16Rik, Gabrb-2
MMRRC Submission 041009-MU
Accession Numbers

Genbank: NM_008070

Is this an essential gene? Possibly non essential (E-score: 0.401) question?
Stock #R4168 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location42419757-42629028 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 42421328 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007797] [ENSMUST00000192403]
Predicted Effect probably benign
Transcript: ENSMUST00000007797
SMART Domains Protein: ENSMUSP00000007797
Gene: ENSMUSG00000007653

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Neur_chan_LBD 36 242 8.7e-52 PFAM
Pfam:Neur_chan_memb 249 469 7.5e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143626
Predicted Effect probably benign
Transcript: ENSMUST00000192403
SMART Domains Protein: ENSMUSP00000141868
Gene: ENSMUSG00000007653

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Neur_chan_LBD 36 242 1.1e-54 PFAM
Pfam:Neur_chan_memb 249 507 6.6e-55 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes GABA A receptor, beta 2 subunit. It is mapped to chromosome 5q34 in a cluster comprised of genes encoding alpha 1 and gamma 2 subunits of the GABA A receptor. Alternative splicing of this gene generates 2 transcript variants, differing by a 114 bp insertion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show hyperactivity and abnormal GABA-mediated receptor currents. Homozygotes for a derivative of this allele show a sexually dimorphic cochlear phenotype associated with OHC dysfunction. Homozygotes for a knock-in allele show altered behavioral response to etomidate. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,137,109 L151P probably benign Het
C3 A T 17: 57,218,608 F883I probably benign Het
Cbr4 T A 8: 61,491,521 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Chpf2 T C 5: 24,591,790 V578A possibly damaging Het
Clasrp A G 7: 19,581,154 probably benign Het
Cmip A T 8: 117,456,917 N743I probably damaging Het
Ctif A C 18: 75,637,215 L33R probably damaging Het
Dmap1 T A 4: 117,681,310 H54L possibly damaging Het
Elk3 A G 10: 93,265,335 probably null Het
Flt4 G A 11: 49,630,573 R440H probably benign Het
Gm12789 A G 4: 101,989,962 Y148C possibly damaging Het
Gm5724 T C 6: 141,738,947 I261V probably benign Het
Haspin A G 11: 73,136,022 L747P probably damaging Het
Intu C T 3: 40,672,623 P278L probably benign Het
Kif27 A G 13: 58,345,748 I127T probably benign Het
Mogat1 T C 1: 78,512,035 V25A possibly damaging Het
Nop14 A G 5: 34,656,744 S157P probably damaging Het
Olfr1040 A G 2: 86,146,179 I185T probably benign Het
Olfr1167 T C 2: 88,149,845 H58R probably damaging Het
Olfr195 A T 16: 59,149,000 Y50F probably benign Het
Oxct2b T C 4: 123,117,685 L466P probably damaging Het
Padi6 A G 4: 140,741,934 C32R probably damaging Het
Pla2r1 A T 2: 60,497,614 Y501* probably null Het
Rb1cc1 G A 1: 6,230,024 V8I probably damaging Het
Rexo5 A G 7: 119,827,398 probably benign Het
Tmem119 T C 5: 113,794,987 E251G probably benign Het
Vmn2r112 T A 17: 22,603,088 M249K probably benign Het
Zc2hc1a A G 3: 7,518,391 T41A probably benign Het
Zfp128 A G 7: 12,890,362 D219G probably benign Het
Znrf2 T C 6: 54,863,960 V173A possibly damaging Het
Other mutations in Gabrb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02275:Gabrb2 APN 11 42591894 missense probably benign 0.00
IGL02666:Gabrb2 APN 11 42529495 critical splice donor site probably null
IGL02983:Gabrb2 APN 11 42421400 missense probably benign 0.00
IGL03357:Gabrb2 APN 11 42591944 missense probably damaging 1.00
H2330:Gabrb2 UTSW 11 42421431 splice site probably benign
R0049:Gabrb2 UTSW 11 42593847 missense probably damaging 1.00
R0049:Gabrb2 UTSW 11 42593847 missense probably damaging 1.00
R0100:Gabrb2 UTSW 11 42487314 missense probably damaging 1.00
R1423:Gabrb2 UTSW 11 42529471 missense probably damaging 1.00
R1526:Gabrb2 UTSW 11 42591888 missense possibly damaging 0.83
R1856:Gabrb2 UTSW 11 42626713 missense probably benign 0.01
R1898:Gabrb2 UTSW 11 42593832 missense possibly damaging 0.51
R2184:Gabrb2 UTSW 11 42421428 critical splice donor site probably null
R2371:Gabrb2 UTSW 11 42591864 missense probably damaging 1.00
R2915:Gabrb2 UTSW 11 42591907 missense probably benign
R2993:Gabrb2 UTSW 11 42597649 missense probably damaging 0.99
R3951:Gabrb2 UTSW 11 42626881 missense probably damaging 1.00
R4167:Gabrb2 UTSW 11 42421328 unclassified probably benign
R4497:Gabrb2 UTSW 11 42597694 missense probably benign 0.05
R4572:Gabrb2 UTSW 11 42593917 missense possibly damaging 0.46
R4784:Gabrb2 UTSW 11 42597642 missense probably damaging 1.00
R4792:Gabrb2 UTSW 11 42529503 splice site probably benign
R5345:Gabrb2 UTSW 11 42626809 missense possibly damaging 0.54
R5346:Gabrb2 UTSW 11 42421389 missense probably benign
R5575:Gabrb2 UTSW 11 42529538 intron probably benign
R5701:Gabrb2 UTSW 11 42487374 missense probably damaging 1.00
R5801:Gabrb2 UTSW 11 42421389 missense probably benign 0.00
R5965:Gabrb2 UTSW 11 42626869 missense probably damaging 1.00
R6738:Gabrb2 UTSW 11 42593931 missense possibly damaging 0.95
R6930:Gabrb2 UTSW 11 42597613 missense probably damaging 1.00
R7011:Gabrb2 UTSW 11 42626661 missense possibly damaging 0.76
R7045:Gabrb2 UTSW 11 42593931 missense probably damaging 1.00
R7615:Gabrb2 UTSW 11 42626742 missense probably benign 0.06
R7653:Gabrb2 UTSW 11 42487212 missense probably damaging 1.00
R7866:Gabrb2 UTSW 11 42487223 nonsense probably null
R8094:Gabrb2 UTSW 11 42597543 missense probably damaging 0.98
RF008:Gabrb2 UTSW 11 42626878 missense probably damaging 1.00
X0020:Gabrb2 UTSW 11 42422646 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- ACTCTGGATGCATTTCTGGG -3'
(R):5'- TTCAACAGCCCTGCTCACAG -3'

Sequencing Primer
(F):5'- CTCTGGATGCATTTCTGGGGTAGTAG -3'
(R):5'- TGCTCACAGAGAGGTATGCAGAC -3'
Posted On2015-06-12