Incidental Mutation 'R4168:Flt4'
ID320666
Institutional Source Beutler Lab
Gene Symbol Flt4
Ensembl Gene ENSMUSG00000020357
Gene NameFMS-like tyrosine kinase 4
SynonymsVEGFR-3, Flt-4, VEGFR3
MMRRC Submission 041009-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4168 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location49609263-49652739 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 49630573 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 440 (R440H)
Ref Sequence ENSEMBL: ENSMUSP00000020617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020617]
Predicted Effect probably benign
Transcript: ENSMUST00000020617
AA Change: R440H

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000020617
Gene: ENSMUSG00000020357
AA Change: R440H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 36 133 3.73e0 SMART
IG 237 328 3.15e-10 SMART
IG 341 419 4.5e0 SMART
IG 430 552 8.46e-2 SMART
IGc2 569 660 1.29e-6 SMART
IGc2 690 755 2.48e-17 SMART
transmembrane domain 776 798 N/A INTRINSIC
TyrKc 845 1169 2.2e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152253
Meta Mutation Damage Score 0.1169 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine kinase receptor for vascular endothelial growth factors C and D. The protein is thought to be involved in lymphangiogenesis and maintenance of the lymphatic endothelium. Mutations in this gene cause hereditary lymphedema type IA. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a targeted null mutation show growth retardation, vascular abnormalities, severe anemia and die from cardiovascular failure at embryonic day 9.5. Heterozygotes for another mutation show abdominal chylous ascites, abnormal lymphaticvessels, and lymphedema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,137,109 L151P probably benign Het
C3 A T 17: 57,218,608 F883I probably benign Het
Cbr4 T A 8: 61,491,521 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Chpf2 T C 5: 24,591,790 V578A possibly damaging Het
Clasrp A G 7: 19,581,154 probably benign Het
Cmip A T 8: 117,456,917 N743I probably damaging Het
Ctif A C 18: 75,637,215 L33R probably damaging Het
Dmap1 T A 4: 117,681,310 H54L possibly damaging Het
Elk3 A G 10: 93,265,335 probably null Het
Gabrb2 A T 11: 42,421,328 probably benign Het
Gm12789 A G 4: 101,989,962 Y148C possibly damaging Het
Gm5724 T C 6: 141,738,947 I261V probably benign Het
Haspin A G 11: 73,136,022 L747P probably damaging Het
Intu C T 3: 40,672,623 P278L probably benign Het
Kif27 A G 13: 58,345,748 I127T probably benign Het
Mogat1 T C 1: 78,512,035 V25A possibly damaging Het
Nop14 A G 5: 34,656,744 S157P probably damaging Het
Olfr1040 A G 2: 86,146,179 I185T probably benign Het
Olfr1167 T C 2: 88,149,845 H58R probably damaging Het
Olfr195 A T 16: 59,149,000 Y50F probably benign Het
Oxct2b T C 4: 123,117,685 L466P probably damaging Het
Padi6 A G 4: 140,741,934 C32R probably damaging Het
Pla2r1 A T 2: 60,497,614 Y501* probably null Het
Rb1cc1 G A 1: 6,230,024 V8I probably damaging Het
Rexo5 A G 7: 119,827,398 probably benign Het
Tmem119 T C 5: 113,794,987 E251G probably benign Het
Vmn2r112 T A 17: 22,603,088 M249K probably benign Het
Zc2hc1a A G 3: 7,518,391 T41A probably benign Het
Zfp128 A G 7: 12,890,362 D219G probably benign Het
Znrf2 T C 6: 54,863,960 V173A possibly damaging Het
Other mutations in Flt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Flt4 APN 11 49635261 missense probably damaging 1.00
IGL01140:Flt4 APN 11 49634943 nonsense probably null
IGL01360:Flt4 APN 11 49643506 missense probably benign 0.04
IGL01386:Flt4 APN 11 49637335 missense probably benign 0.00
IGL01769:Flt4 APN 11 49635171 splice site probably benign
IGL02189:Flt4 APN 11 49626003 missense probably damaging 1.00
IGL02206:Flt4 APN 11 49630390 missense probably damaging 0.98
IGL02324:Flt4 APN 11 49645995 missense probably benign 0.13
IGL02433:Flt4 APN 11 49630573 missense probably benign 0.01
IGL03009:Flt4 APN 11 49627124 missense probably benign 0.02
IGL03035:Flt4 APN 11 49645897 nonsense probably null
IGL03059:Flt4 APN 11 49642307 missense probably damaging 0.97
IGL03350:Flt4 APN 11 49634793 nonsense probably null
PIT4802001:Flt4 UTSW 11 49633169 missense probably benign
R0360:Flt4 UTSW 11 49636991 missense probably benign 0.02
R0364:Flt4 UTSW 11 49636991 missense probably benign 0.02
R0386:Flt4 UTSW 11 49644386 missense probably benign 0.00
R0395:Flt4 UTSW 11 49630343 missense probably benign 0.00
R0600:Flt4 UTSW 11 49636339 splice site probably benign
R0666:Flt4 UTSW 11 49625447 missense possibly damaging 0.53
R0720:Flt4 UTSW 11 49636339 splice site probably benign
R0734:Flt4 UTSW 11 49626717 missense possibly damaging 0.67
R0973:Flt4 UTSW 11 49636339 splice site probably benign
R1013:Flt4 UTSW 11 49636339 splice site probably benign
R1103:Flt4 UTSW 11 49636339 splice site probably benign
R1104:Flt4 UTSW 11 49636339 splice site probably benign
R1162:Flt4 UTSW 11 49636339 splice site probably benign
R1241:Flt4 UTSW 11 49636339 splice site probably benign
R1401:Flt4 UTSW 11 49636339 splice site probably benign
R1487:Flt4 UTSW 11 49633144 missense possibly damaging 0.86
R1546:Flt4 UTSW 11 49631981 missense probably benign 0.03
R1999:Flt4 UTSW 11 49645997 missense probably benign 0.00
R2110:Flt4 UTSW 11 49625304 missense probably benign 0.03
R2150:Flt4 UTSW 11 49645997 missense probably benign 0.00
R2189:Flt4 UTSW 11 49635698 missense probably benign 0.24
R2217:Flt4 UTSW 11 49624728 missense probably benign 0.00
R2218:Flt4 UTSW 11 49624728 missense probably benign 0.00
R2249:Flt4 UTSW 11 49645959 missense possibly damaging 0.66
R2402:Flt4 UTSW 11 49637819 missense possibly damaging 0.82
R3508:Flt4 UTSW 11 49634114 missense probably damaging 0.99
R3974:Flt4 UTSW 11 49636740 missense probably damaging 0.99
R4700:Flt4 UTSW 11 49626444 intron probably benign
R4701:Flt4 UTSW 11 49626808 missense possibly damaging 0.49
R4714:Flt4 UTSW 11 49627207 missense probably damaging 0.99
R4817:Flt4 UTSW 11 49625415 missense probably damaging 0.98
R4921:Flt4 UTSW 11 49627143 missense probably damaging 0.98
R5066:Flt4 UTSW 11 49634163 missense possibly damaging 0.62
R5095:Flt4 UTSW 11 49627159 missense possibly damaging 0.95
R5166:Flt4 UTSW 11 49633257 splice site probably null
R5245:Flt4 UTSW 11 49651034 frame shift probably null
R5250:Flt4 UTSW 11 49630400 missense possibly damaging 0.88
R5400:Flt4 UTSW 11 49651034 frame shift probably null
R5401:Flt4 UTSW 11 49651034 frame shift probably null
R5402:Flt4 UTSW 11 49651034 frame shift probably null
R5527:Flt4 UTSW 11 49634754 missense probably damaging 1.00
R5686:Flt4 UTSW 11 49630603 missense probably benign 0.00
R5766:Flt4 UTSW 11 49626686 missense possibly damaging 0.75
R5996:Flt4 UTSW 11 49651070 missense probably damaging 1.00
R6037:Flt4 UTSW 11 49637040 missense probably damaging 1.00
R6037:Flt4 UTSW 11 49637040 missense probably damaging 1.00
R6352:Flt4 UTSW 11 49643506 missense probably benign 0.04
R6361:Flt4 UTSW 11 49630578 missense probably benign 0.00
R6574:Flt4 UTSW 11 49625372 missense probably benign
R7205:Flt4 UTSW 11 49634298 missense probably null 0.78
R7216:Flt4 UTSW 11 49634681 missense possibly damaging 0.73
R7257:Flt4 UTSW 11 49626009 missense probably benign 0.22
R7457:Flt4 UTSW 11 49630328 missense possibly damaging 0.89
R7559:Flt4 UTSW 11 49644371 missense possibly damaging 0.50
R8181:Flt4 UTSW 11 49634896 missense probably damaging 0.99
R8286:Flt4 UTSW 11 49637262 missense probably benign 0.00
X0017:Flt4 UTSW 11 49626733 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACATCAGTCTGGAGCTGGTG -3'
(R):5'- AGGAGCATGCCTCATTTGGG -3'

Sequencing Primer
(F):5'- GGTGAATGGTATAGCCCCG -3'
(R):5'- AGCTTGGGAAATTTGTCTCCC -3'
Posted On2015-06-12