Incidental Mutation 'R4168:Haspin'
ID320667
Institutional Source Beutler Lab
Gene Symbol Haspin
Ensembl Gene ENSMUSG00000050107
Gene Namehistone H3 associated protein kinase
SynonymsGsg2
MMRRC Submission 041009-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.697) question?
Stock #R4168 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73135485-73138294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73136022 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 747 (L747P)
Ref Sequence ENSEMBL: ENSMUSP00000055806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000052140] [ENSMUST00000102537]
Predicted Effect probably benign
Transcript: ENSMUST00000006101
SMART Domains Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 1e-24 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 1.1e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000052140
AA Change: L747P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055806
Gene: ENSMUSG00000050107
AA Change: L747P

DomainStartEndE-ValueType
low complexity region 61 67 N/A INTRINSIC
low complexity region 74 89 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
low complexity region 357 378 N/A INTRINSIC
SCOP:d1h8fa_ 437 619 1e-8 SMART
DUF3635 664 753 3.83e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102537
SMART Domains Protein: ENSMUSP00000099596
Gene: ENSMUSG00000005947

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 5e-25 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
Meta Mutation Damage Score 0.9482 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,137,109 L151P probably benign Het
C3 A T 17: 57,218,608 F883I probably benign Het
Cbr4 T A 8: 61,491,521 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Chpf2 T C 5: 24,591,790 V578A possibly damaging Het
Clasrp A G 7: 19,581,154 probably benign Het
Cmip A T 8: 117,456,917 N743I probably damaging Het
Ctif A C 18: 75,637,215 L33R probably damaging Het
Dmap1 T A 4: 117,681,310 H54L possibly damaging Het
Elk3 A G 10: 93,265,335 probably null Het
Flt4 G A 11: 49,630,573 R440H probably benign Het
Gabrb2 A T 11: 42,421,328 probably benign Het
Gm12789 A G 4: 101,989,962 Y148C possibly damaging Het
Gm5724 T C 6: 141,738,947 I261V probably benign Het
Intu C T 3: 40,672,623 P278L probably benign Het
Kif27 A G 13: 58,345,748 I127T probably benign Het
Mogat1 T C 1: 78,512,035 V25A possibly damaging Het
Nop14 A G 5: 34,656,744 S157P probably damaging Het
Olfr1040 A G 2: 86,146,179 I185T probably benign Het
Olfr1167 T C 2: 88,149,845 H58R probably damaging Het
Olfr195 A T 16: 59,149,000 Y50F probably benign Het
Oxct2b T C 4: 123,117,685 L466P probably damaging Het
Padi6 A G 4: 140,741,934 C32R probably damaging Het
Pla2r1 A T 2: 60,497,614 Y501* probably null Het
Rb1cc1 G A 1: 6,230,024 V8I probably damaging Het
Rexo5 A G 7: 119,827,398 probably benign Het
Tmem119 T C 5: 113,794,987 E251G probably benign Het
Vmn2r112 T A 17: 22,603,088 M249K probably benign Het
Zc2hc1a A G 3: 7,518,391 T41A probably benign Het
Zfp128 A G 7: 12,890,362 D219G probably benign Het
Znrf2 T C 6: 54,863,960 V173A possibly damaging Het
Other mutations in Haspin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Haspin APN 11 73137405 missense possibly damaging 0.85
IGL03088:Haspin APN 11 73136625 missense probably damaging 1.00
IGL03103:Haspin APN 11 73136700 missense probably damaging 1.00
Suddenly UTSW 11 73136886 missense probably benign 0.02
yesterday UTSW 11 73137551 nonsense probably null
R0034:Haspin UTSW 11 73138218 missense probably damaging 1.00
R0276:Haspin UTSW 11 73136487 missense probably damaging 1.00
R0313:Haspin UTSW 11 73136298 missense probably damaging 0.97
R2165:Haspin UTSW 11 73136630 missense probably damaging 1.00
R2326:Haspin UTSW 11 73136085 missense probably benign 0.05
R3950:Haspin UTSW 11 73136395 missense probably damaging 1.00
R4565:Haspin UTSW 11 73137619 missense probably benign 0.00
R6532:Haspin UTSW 11 73137551 nonsense probably null
R6552:Haspin UTSW 11 73137564 missense probably benign 0.02
R6952:Haspin UTSW 11 73136145 missense possibly damaging 0.95
R7237:Haspin UTSW 11 73136886 missense probably benign 0.02
R7512:Haspin UTSW 11 73136592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATGTGTCCACTTGTCCTCTG -3'
(R):5'- AAACTGCTGGGGTGAGTATC -3'

Sequencing Primer
(F):5'- CATGTCAACAAATGTTTTGGTTACC -3'
(R):5'- CACCCTTACAATAATGTGCTGTGG -3'
Posted On2015-06-12