Incidental Mutation 'R4168:Cd200r3'
ID320671
Institutional Source Beutler Lab
Gene Symbol Cd200r3
Ensembl Gene ENSMUSG00000036172
Gene NameCD200 receptor 3
Synonyms4833409J19Rik, mCD200RLb, 4733401I18Rik
MMRRC Submission 041009-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R4168 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location44943678-44981380 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44954189 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 188 (D188E)
Ref Sequence ENSEMBL: ENSMUSP00000128974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048479] [ENSMUST00000077178] [ENSMUST00000114611] [ENSMUST00000114612] [ENSMUST00000114613] [ENSMUST00000114622] [ENSMUST00000164007] [ENSMUST00000166731] [ENSMUST00000171779]
Predicted Effect probably benign
Transcript: ENSMUST00000048479
AA Change: D188E

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000036624
Gene: ENSMUSG00000036172
AA Change: D188E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 1e-42 PDB
Blast:IG 65 163 1e-21 BLAST
Blast:IG_like 165 270 8e-32 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000077178
SMART Domains Protein: ENSMUSP00000076421
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 163 1e-12 PDB
Blast:IG 65 163 2e-22 BLAST
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114611
AA Change: D188E

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110258
Gene: ENSMUSG00000036172
AA Change: D188E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 9e-43 PDB
Blast:IG 65 163 1e-21 BLAST
Blast:IG_like 165 273 2e-32 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000114612
SMART Domains Protein: ENSMUSP00000110259
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 163 8e-13 PDB
Blast:IG 65 163 2e-22 BLAST
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114613
AA Change: D188E

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110260
Gene: ENSMUSG00000036172
AA Change: D188E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 9e-43 PDB
Blast:IG 65 163 1e-21 BLAST
Blast:IG_like 165 274 2e-32 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000114622
SMART Domains Protein: ENSMUSP00000110269
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
Pfam:V-set 22 164 6.9e-6 PFAM
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164007
AA Change: D188E

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130480
Gene: ENSMUSG00000036172
AA Change: D188E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 1e-42 PDB
Blast:IG 65 163 1e-21 BLAST
Blast:IG_like 165 273 2e-32 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000166731
AA Change: D188E

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128974
Gene: ENSMUSG00000036172
AA Change: D188E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 8e-43 PDB
Blast:IG 65 163 9e-22 BLAST
Blast:IG_like 165 273 2e-32 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000171779
SMART Domains Protein: ENSMUSP00000132938
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
Pfam:V-set 22 164 6.7e-6 PFAM
transmembrane domain 171 193 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,137,109 L151P probably benign Het
C3 A T 17: 57,218,608 F883I probably benign Het
Cbr4 T A 8: 61,491,521 probably benign Het
Chpf2 T C 5: 24,591,790 V578A possibly damaging Het
Clasrp A G 7: 19,581,154 probably benign Het
Cmip A T 8: 117,456,917 N743I probably damaging Het
Ctif A C 18: 75,637,215 L33R probably damaging Het
Dmap1 T A 4: 117,681,310 H54L possibly damaging Het
Elk3 A G 10: 93,265,335 probably null Het
Flt4 G A 11: 49,630,573 R440H probably benign Het
Gabrb2 A T 11: 42,421,328 probably benign Het
Gm12789 A G 4: 101,989,962 Y148C possibly damaging Het
Gm5724 T C 6: 141,738,947 I261V probably benign Het
Haspin A G 11: 73,136,022 L747P probably damaging Het
Intu C T 3: 40,672,623 P278L probably benign Het
Kif27 A G 13: 58,345,748 I127T probably benign Het
Mogat1 T C 1: 78,512,035 V25A possibly damaging Het
Nop14 A G 5: 34,656,744 S157P probably damaging Het
Olfr1040 A G 2: 86,146,179 I185T probably benign Het
Olfr1167 T C 2: 88,149,845 H58R probably damaging Het
Olfr195 A T 16: 59,149,000 Y50F probably benign Het
Oxct2b T C 4: 123,117,685 L466P probably damaging Het
Padi6 A G 4: 140,741,934 C32R probably damaging Het
Pla2r1 A T 2: 60,497,614 Y501* probably null Het
Rb1cc1 G A 1: 6,230,024 V8I probably damaging Het
Rexo5 A G 7: 119,827,398 probably benign Het
Tmem119 T C 5: 113,794,987 E251G probably benign Het
Vmn2r112 T A 17: 22,603,088 M249K probably benign Het
Zc2hc1a A G 3: 7,518,391 T41A probably benign Het
Zfp128 A G 7: 12,890,362 D219G probably benign Het
Znrf2 T C 6: 54,863,960 V173A possibly damaging Het
Other mutations in Cd200r3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02996:Cd200r3 APN 16 44954317 missense probably damaging 1.00
IGL03003:Cd200r3 APN 16 44943775 start codon destroyed probably null 0.90
IGL03003:Cd200r3 APN 16 44943776 missense probably benign 0.01
IGL03005:Cd200r3 APN 16 44953610 missense probably damaging 1.00
IGL03354:Cd200r3 APN 16 44953597 missense possibly damaging 0.64
R0620:Cd200r3 UTSW 16 44957717 splice site probably null
R1451:Cd200r3 UTSW 16 44951547 missense possibly damaging 0.76
R1623:Cd200r3 UTSW 16 44951448 missense possibly damaging 0.71
R2980:Cd200r3 UTSW 16 44954189 missense probably benign 0.25
R2982:Cd200r3 UTSW 16 44954189 missense probably benign 0.25
R3758:Cd200r3 UTSW 16 44964628 intron probably null
R4167:Cd200r3 UTSW 16 44954189 missense probably benign 0.25
R4175:Cd200r3 UTSW 16 44954189 missense probably benign 0.25
R4534:Cd200r3 UTSW 16 44954189 missense probably benign 0.25
R4535:Cd200r3 UTSW 16 44954189 missense probably benign 0.25
R4801:Cd200r3 UTSW 16 44957825 missense possibly damaging 0.82
R4802:Cd200r3 UTSW 16 44957825 missense possibly damaging 0.82
R4937:Cd200r3 UTSW 16 44954259 missense probably benign 0.01
R5460:Cd200r3 UTSW 16 44957730 missense possibly damaging 0.66
R6109:Cd200r3 UTSW 16 44953682 missense probably benign 0.02
R8071:Cd200r3 UTSW 16 44954140 missense probably damaging 1.00
R8110:Cd200r3 UTSW 16 44951472 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- AGTGCCAGGTAAGCCACATAC -3'
(R):5'- GCCACATTTGTCACAAACAGATAG -3'

Sequencing Primer
(F):5'- GAGGTGCATCATCTCTGACTGAAC -3'
(R):5'- TTCTTCTTTTTAAAAATGGGGCAGG -3'
Posted On2015-06-12