Incidental Mutation 'R4168:Olfr195'
ID320672
Institutional Source Beutler Lab
Gene Symbol Olfr195
Ensembl Gene ENSMUSG00000062608
Gene Nameolfactory receptor 195
SynonymsMOR184-5, GA_x54KRFPKG5P-55369823-55370749
MMRRC Submission 041009-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R4168 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location59147046-59150777 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59149000 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 50 (Y50F)
Ref Sequence ENSEMBL: ENSMUSP00000150249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075381] [ENSMUST00000216957]
Predicted Effect probably benign
Transcript: ENSMUST00000075381
AA Change: Y50F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000073737
Gene: ENSMUSG00000062608
AA Change: Y50F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.1e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 161 2.7e-8 PFAM
Pfam:7tm_1 41 307 9.4e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208239
AA Change: Y50F
Predicted Effect probably benign
Transcript: ENSMUST00000216957
AA Change: Y50F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0667 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,137,109 L151P probably benign Het
C3 A T 17: 57,218,608 F883I probably benign Het
Cbr4 T A 8: 61,491,521 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Chpf2 T C 5: 24,591,790 V578A possibly damaging Het
Clasrp A G 7: 19,581,154 probably benign Het
Cmip A T 8: 117,456,917 N743I probably damaging Het
Ctif A C 18: 75,637,215 L33R probably damaging Het
Dmap1 T A 4: 117,681,310 H54L possibly damaging Het
Elk3 A G 10: 93,265,335 probably null Het
Flt4 G A 11: 49,630,573 R440H probably benign Het
Gabrb2 A T 11: 42,421,328 probably benign Het
Gm12789 A G 4: 101,989,962 Y148C possibly damaging Het
Gm5724 T C 6: 141,738,947 I261V probably benign Het
Haspin A G 11: 73,136,022 L747P probably damaging Het
Intu C T 3: 40,672,623 P278L probably benign Het
Kif27 A G 13: 58,345,748 I127T probably benign Het
Mogat1 T C 1: 78,512,035 V25A possibly damaging Het
Nop14 A G 5: 34,656,744 S157P probably damaging Het
Olfr1040 A G 2: 86,146,179 I185T probably benign Het
Olfr1167 T C 2: 88,149,845 H58R probably damaging Het
Oxct2b T C 4: 123,117,685 L466P probably damaging Het
Padi6 A G 4: 140,741,934 C32R probably damaging Het
Pla2r1 A T 2: 60,497,614 Y501* probably null Het
Rb1cc1 G A 1: 6,230,024 V8I probably damaging Het
Rexo5 A G 7: 119,827,398 probably benign Het
Tmem119 T C 5: 113,794,987 E251G probably benign Het
Vmn2r112 T A 17: 22,603,088 M249K probably benign Het
Zc2hc1a A G 3: 7,518,391 T41A probably benign Het
Zfp128 A G 7: 12,890,362 D219G probably benign Het
Znrf2 T C 6: 54,863,960 V173A possibly damaging Het
Other mutations in Olfr195
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01937:Olfr195 APN 16 59149464 missense probably benign 0.01
IGL01945:Olfr195 APN 16 59149464 missense probably benign 0.01
R0071:Olfr195 UTSW 16 59149215 missense probably benign 0.23
R0390:Olfr195 UTSW 16 59149299 missense probably benign 0.01
R0601:Olfr195 UTSW 16 59149754 missense probably benign 0.00
R1499:Olfr195 UTSW 16 59148924 missense probably benign
R1612:Olfr195 UTSW 16 59149624 missense probably benign 0.00
R1785:Olfr195 UTSW 16 59149297 missense probably damaging 1.00
R2082:Olfr195 UTSW 16 59148885 missense probably damaging 0.99
R3605:Olfr195 UTSW 16 59149483 missense probably damaging 1.00
R4839:Olfr195 UTSW 16 59149030 missense probably damaging 1.00
R4989:Olfr195 UTSW 16 59149618 missense probably damaging 1.00
R5285:Olfr195 UTSW 16 59149270 missense probably damaging 1.00
R7107:Olfr195 UTSW 16 59148916 missense probably benign 0.10
R7136:Olfr195 UTSW 16 59148964 missense probably damaging 1.00
R7317:Olfr195 UTSW 16 59149321 missense possibly damaging 0.80
R7601:Olfr195 UTSW 16 59149234 missense probably benign 0.01
R7729:Olfr195 UTSW 16 59149207 missense probably damaging 1.00
R8004:Olfr195 UTSW 16 59148988 missense probably damaging 1.00
R8208:Olfr195 UTSW 16 59149019 missense probably benign 0.41
R8282:Olfr195 UTSW 16 59149166 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTATATCTTTGTGATTCCAGTGGCAAC -3'
(R):5'- TCATAGGCCATTGCTGCCAG -3'

Sequencing Primer
(F):5'- CAACAGAGAAGGTGAGATGGCTG -3'
(R):5'- GCAGTCTGTAGTTTCAGCAAGAC -3'
Posted On2015-06-12