Mutagenetix > Incidental Mutations

Incidental Mutation 'R4169:Ampd1'

320683

Institutional Source

Beutler Lab

Gene Symbol

Ampd1

Ensembl Gene

ENSMUSG00000070385

Gene Name

adenosine monophosphate deaminase 1

Synonyms

Ampd-1

MMRRC Submission

041010-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.141) question?

Stock #

R4169 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103074014-103099720 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 103094841 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 546 (M546K)

Ref Sequence

ENSEMBL: ENSMUSP00000143129 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090715] [ENSMUST00000155034]

AlphaFold

Q3V1D3

Predicted Effect

probably damaging
Transcript: ENSMUST00000090715
AA Change: M546K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000088217
Gene: ENSMUSG00000070385
AA Change: M546K

Domain	Start	End	E-Value	Type
low complexity region	234	246	N/A	INTRINSIC
Pfam:A_deaminase	294	701	5.4e-136	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000155034
AA Change: M546K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143129
Gene: ENSMUSG00000070385
AA Change: M546K

Domain	Start	End	E-Value	Type
low complexity region	234	246	N/A	INTRINSIC
Pfam:A_deaminase	294	676	5.2e-103	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000177250
AA Change: M47K

SMART Domains

Protein: ENSMUSP00000134772
Gene: ENSMUSG00000070385
AA Change: M47K

Domain	Start	End	E-Value	Type
Pfam:A_deaminase	22	203	1.4e-82	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198198

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199407

Meta Mutation Damage Score

0.6483

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.8%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenosine monophosphate deaminase 1 catalyzes the deamination of AMP to IMP in skeletal muscle and plays an important role in the purine nucleotide cycle. Two other genes have been identified, AMPD2 and AMPD3, for the liver- and erythocyte-specific isoforms, respectively. Deficiency of the muscle-specific enzyme is apparently a common cause of exercise-induced myopathy and probably the most common cause of metabolic myopathy in the human. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Feb 2010]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot7	T	C	4: 152,217,793	C121R	probably damaging	Het
Birc3	T	A	9: 7,849,683	D535V	possibly damaging	Het
Btn1a1	A	G	13: 23,465,155	L9P	probably benign	Het
Cmip	A	T	8: 117,456,917	N743I	probably damaging	Het
Col4a2	C	T	8: 11,429,391	P758L	probably benign	Het
Ddx50	A	T	10: 62,640,770	Y241*	probably null	Het
Elk3	A	G	10: 93,265,335		probably null	Het
Fbn1	T	C	2: 125,363,952	T1042A	possibly damaging	Het
Gm5445	A	G	13: 12,378,646		noncoding transcript	Het
Gnat3	T	C	5: 18,003,864	F189L	probably damaging	Het
Hectd1	T	C	12: 51,790,225	T815A	probably damaging	Het
Hmcn1	A	C	1: 150,595,999		probably null	Het
Hrc	A	G	7: 45,336,757	D444G	probably benign	Het
Ighv1-53	T	A	12: 115,158,546	I70F	possibly damaging	Het
Kat7	A	G	11: 95,280,472	F469L	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Krt81	T	A	15: 101,461,312	M242L	probably benign	Het
Krtap6-1	A	G	16: 89,031,696		probably null	Het
Man2c1	A	G	9: 57,138,026	D473G	probably benign	Het
Mthfr-ps1	T	C	5: 78,474,589		noncoding transcript	Het
Nop53	A	T	7: 15,942,319	W152R	probably benign	Het
Olfr220	T	A	1: 174,449,596	S324R	unknown	Het
Olfr281	A	G	15: 98,456,997	E229G	probably benign	Het
Olfr482	A	T	7: 108,095,384	M62K	probably damaging	Het
Pcdh1	A	T	18: 38,198,305	N548K	probably damaging	Het
Pcdhga12	A	G	18: 37,766,414	I100V	probably benign	Het
Piezo2	T	C	18: 63,050,604	H1743R	probably benign	Het
Pkdrej	A	G	15: 85,816,314	V1807A	probably benign	Het
Rabl2	T	C	15: 89,590,379	M1V	probably null	Het
Rexo5	A	G	7: 119,827,398		probably benign	Het
Rfng	C	G	11: 120,783,946	G73R	probably benign	Het
Rps6ka4	A	G	19: 6,831,820	L459P	possibly damaging	Het
Samd11	T	A	4: 156,247,746	D536V	probably damaging	Het
Slc9a5	A	G	8: 105,357,400	T451A	possibly damaging	Het
Snapc1	T	A	12: 73,982,491	N349K	probably benign	Het
Sox1ot	A	G	8: 12,430,544		noncoding transcript	Het
Tmem178	C	T	17: 80,944,803	H39Y	possibly damaging	Het
Trav8n-2	A	T	14: 53,346,418	T111S	possibly damaging	Het
Ttn	T	A	2: 76,872,759		probably benign	Het
Ttn	T	C	2: 76,932,565	D3250G	probably damaging	Het
Ube2nl	T	A	7: 61,549,632		noncoding transcript	Het
Vps25	T	C	11: 101,254,092	S39P	probably damaging	Het
Zkscan14	G	A	5: 145,196,175	T182I	possibly damaging	Het

Other mutations in Ampd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00839:Ampd1	APN	3	103099694	missense	possibly damaging	0.64
IGL00909:Ampd1	APN	3	103088428	missense	probably benign	0.10
IGL01543:Ampd1	APN	3	103095713	missense	probably benign	0.00
IGL01743:Ampd1	APN	3	103094885	splice site	probably benign
IGL02390:Ampd1	APN	3	103079041	missense	probably benign	0.28
IGL02637:Ampd1	APN	3	103094883	splice site	probably benign
IGL02735:Ampd1	APN	3	103085377	missense	probably damaging	1.00
IGL03151:Ampd1	APN	3	103092470	splice site	probably null
twinkle_toes	UTSW	3	103095646	nonsense	probably null
R0158:Ampd1	UTSW	3	103091730	nonsense	probably null
R0441:Ampd1	UTSW	3	103088478	missense	probably benign	0.05
R0646:Ampd1	UTSW	3	103099597	missense	probably damaging	1.00
R1474:Ampd1	UTSW	3	103098838	missense	probably damaging	1.00
R1499:Ampd1	UTSW	3	103091664	missense	probably damaging	1.00
R1789:Ampd1	UTSW	3	103099126	missense	possibly damaging	0.46
R2131:Ampd1	UTSW	3	103094878	critical splice donor site	probably null
R3706:Ampd1	UTSW	3	103088311	splice site	probably benign
R4007:Ampd1	UTSW	3	103092460	missense	probably damaging	0.99
R4525:Ampd1	UTSW	3	103094733	missense	probably damaging	1.00
R4828:Ampd1	UTSW	3	103081097	missense	probably damaging	1.00
R5015:Ampd1	UTSW	3	103099665	missense	possibly damaging	0.89
R5514:Ampd1	UTSW	3	103079172	missense	possibly damaging	0.50
R5839:Ampd1	UTSW	3	103085428	missense	possibly damaging	0.47
R5872:Ampd1	UTSW	3	103079130	missense	probably benign	0.00
R5890:Ampd1	UTSW	3	103090075	missense	probably damaging	1.00
R5986:Ampd1	UTSW	3	103085397	missense	probably damaging	1.00
R6272:Ampd1	UTSW	3	103085383	missense	possibly damaging	0.50
R6473:Ampd1	UTSW	3	103095646	nonsense	probably null
R6504:Ampd1	UTSW	3	103099595	missense	possibly damaging	0.90
R7051:Ampd1	UTSW	3	103090073	missense	probably damaging	1.00
R7323:Ampd1	UTSW	3	103085380	missense	probably benign
R7424:Ampd1	UTSW	3	103088442	missense	probably benign	0.05
R7436:Ampd1	UTSW	3	103074119	critical splice donor site	probably null
R7546:Ampd1	UTSW	3	103095712	missense	probably benign
R8344:Ampd1	UTSW	3	103095686	missense	possibly damaging	0.90
R8366:Ampd1	UTSW	3	103088494	missense	probably damaging	0.99
R8423:Ampd1	UTSW	3	103080989	missense	probably benign
R8543:Ampd1	UTSW	3	103079170	missense	possibly damaging	0.50
R8730:Ampd1	UTSW	3	103085360	nonsense	probably null
R8904:Ampd1	UTSW	3	103081058	missense	probably benign	0.12
R9017:Ampd1	UTSW	3	103088470	missense	probably benign	0.01
R9121:Ampd1	UTSW	3	103098682	nonsense	probably null
R9150:Ampd1	UTSW	3	103081043	missense	possibly damaging	0.49
R9242:Ampd1	UTSW	3	103091620	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGCTGGCCATCACTGACTC -3'
(R):5'- ACCAAGCCTTCATTGTCTGACC -3'

Sequencing Primer
(F):5'- AGTTTCACTGAGTGCAGAGCC -3'
(R):5'- ATTGTCTGACCTCCTCGTGC -3'

Posted On

2015-06-12