Incidental Mutation 'R4169:Acot7'
ID320684
Institutional Source Beutler Lab
Gene Symbol Acot7
Ensembl Gene ENSMUSG00000028937
Gene Nameacyl-CoA thioesterase 7
Synonyms2410041A17Rik, Bach, AU014716
MMRRC Submission 041010-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R4169 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location152178134-152271855 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 152217793 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 121 (C121R)
Ref Sequence ENSEMBL: ENSMUSP00000129121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030779] [ENSMUST00000075363] [ENSMUST00000105652] [ENSMUST00000167926]
Predicted Effect probably damaging
Transcript: ENSMUST00000030779
AA Change: C118R

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030779
Gene: ENSMUSG00000028937
AA Change: C118R

DomainStartEndE-ValueType
Pfam:4HBT 69 152 1e-16 PFAM
Pfam:4HBT 243 318 4.1e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000075363
AA Change: C116R

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074827
Gene: ENSMUSG00000028937
AA Change: C116R

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
low complexity region 30 36 N/A INTRINSIC
Pfam:4HBT 67 150 1.2e-16 PFAM
Pfam:4HBT 241 316 5e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105652
AA Change: C87R

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101277
Gene: ENSMUSG00000028937
AA Change: C87R

DomainStartEndE-ValueType
Pfam:4HBT 38 121 1.1e-16 PFAM
Pfam:4HBT 212 287 4.4e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144733
Predicted Effect probably damaging
Transcript: ENSMUST00000167926
AA Change: C121R

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129121
Gene: ENSMUSG00000028937
AA Change: C121R

DomainStartEndE-ValueType
Pfam:4HBT 72 155 2.3e-17 PFAM
Pfam:4HBT 246 320 1.2e-19 PFAM
Meta Mutation Damage Score 0.0976 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl coenzyme family. The encoded protein hydrolyzes the CoA thioester of palmitoyl-CoA and other long-chain fatty acids. Decreased expression of this gene may be associated with mesial temporal lobe epilepsy. Alternatively spliced transcript variants encoding distinct isoforms with different subcellular locations have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a floxed allele activated in neurons exhibit abnormal glucose and lipid homeostasis, altered metabolism, increaased adiposity, decreased lean mass, progressive neurodegeneration, and neurological defects in aged mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ampd1 T A 3: 103,094,841 M546K probably damaging Het
Birc3 T A 9: 7,849,683 D535V possibly damaging Het
Btn1a1 A G 13: 23,465,155 L9P probably benign Het
Cmip A T 8: 117,456,917 N743I probably damaging Het
Col4a2 C T 8: 11,429,391 P758L probably benign Het
Ddx50 A T 10: 62,640,770 Y241* probably null Het
Elk3 A G 10: 93,265,335 probably null Het
Fbn1 T C 2: 125,363,952 T1042A possibly damaging Het
Gm5445 A G 13: 12,378,646 noncoding transcript Het
Gnat3 T C 5: 18,003,864 F189L probably damaging Het
Hectd1 T C 12: 51,790,225 T815A probably damaging Het
Hmcn1 A C 1: 150,595,999 probably null Het
Hrc A G 7: 45,336,757 D444G probably benign Het
Ighv1-53 T A 12: 115,158,546 I70F possibly damaging Het
Kat7 A G 11: 95,280,472 F469L probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Krt81 T A 15: 101,461,312 M242L probably benign Het
Krtap6-1 A G 16: 89,031,696 probably null Het
Man2c1 A G 9: 57,138,026 D473G probably benign Het
Mthfr-ps1 T C 5: 78,474,589 noncoding transcript Het
Nop53 A T 7: 15,942,319 W152R probably benign Het
Olfr220 T A 1: 174,449,596 S324R unknown Het
Olfr281 A G 15: 98,456,997 E229G probably benign Het
Olfr482 A T 7: 108,095,384 M62K probably damaging Het
Pcdh1 A T 18: 38,198,305 N548K probably damaging Het
Pcdhga12 A G 18: 37,766,414 I100V probably benign Het
Piezo2 T C 18: 63,050,604 H1743R probably benign Het
Pkdrej A G 15: 85,816,314 V1807A probably benign Het
Rabl2 T C 15: 89,590,379 M1V probably null Het
Rexo5 A G 7: 119,827,398 probably benign Het
Rfng C G 11: 120,783,946 G73R probably benign Het
Rps6ka4 A G 19: 6,831,820 L459P possibly damaging Het
Samd11 T A 4: 156,247,746 D536V probably damaging Het
Slc9a5 A G 8: 105,357,400 T451A possibly damaging Het
Snapc1 T A 12: 73,982,491 N349K probably benign Het
Sox1ot A G 8: 12,430,544 noncoding transcript Het
Tmem178 C T 17: 80,944,803 H39Y possibly damaging Het
Trav8n-2 A T 14: 53,346,418 T111S possibly damaging Het
Ttn T A 2: 76,872,759 probably benign Het
Ttn T C 2: 76,932,565 D3250G probably damaging Het
Ube2nl T A 7: 61,549,632 noncoding transcript Het
Vps25 T C 11: 101,254,092 S39P probably damaging Het
Zkscan14 G A 5: 145,196,175 T182I possibly damaging Het
Other mutations in Acot7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Acot7 APN 4 152260896 missense probably benign 0.39
IGL01758:Acot7 APN 4 152217793 missense probably damaging 0.96
IGL01991:Acot7 APN 4 152223079 missense possibly damaging 0.84
R1329:Acot7 UTSW 4 152229784 nonsense probably null
R1605:Acot7 UTSW 4 152206828 missense possibly damaging 0.46
R1625:Acot7 UTSW 4 152186291 missense probably benign 0.01
R1739:Acot7 UTSW 4 152260912 missense probably damaging 1.00
R4473:Acot7 UTSW 4 152206856 missense probably damaging 1.00
R4857:Acot7 UTSW 4 152237754 missense possibly damaging 0.76
R4884:Acot7 UTSW 4 152186207 intron probably benign
R5000:Acot7 UTSW 4 152186363 missense probably benign 0.00
R6123:Acot7 UTSW 4 152199945 missense probably benign
R6633:Acot7 UTSW 4 152178259 missense probably benign
R6938:Acot7 UTSW 4 152217894 critical splice donor site probably null
R7025:Acot7 UTSW 4 152178189 missense unknown
R7813:Acot7 UTSW 4 152223118 missense probably damaging 1.00
R8035:Acot7 UTSW 4 152253154 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TGTCCTGGTAAGCACATGGC -3'
(R):5'- TGTGATCCGTGCTCAAAGATG -3'

Sequencing Primer
(F):5'- ACTTAGGCTAGAAGTGTCCCTCAG -3'
(R):5'- TGCTCAAAGATGCTACCGCTG -3'
Posted On2015-06-12