Incidental Mutation 'R0396:Sdk2'
ID 32070
Institutional Source Beutler Lab
Gene Symbol Sdk2
Ensembl Gene ENSMUSG00000041592
Gene Name sidekick cell adhesion molecule 2
Synonyms 4632412F08Rik, 5330435L01Rik
MMRRC Submission 038602-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R0396 (G1)
Quality Score 169
Status Validated
Chromosome 11
Chromosomal Location 113667200-113957855 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 113720793 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1379 (I1379V)
Ref Sequence ENSEMBL: ENSMUSP00000038972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041627]
AlphaFold Q6V4S5
Predicted Effect probably benign
Transcript: ENSMUST00000041627
AA Change: I1379V

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: I1379V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 43 102 4.67e-4 SMART
IG 123 208 6.07e-3 SMART
IG 225 309 1.4e-7 SMART
IGc2 325 391 6.21e-9 SMART
IGc2 418 486 8.57e-12 SMART
IG 506 591 2.37e-5 SMART
FN3 594 678 1.91e-7 SMART
FN3 694 780 2.42e-9 SMART
FN3 796 884 3.45e-5 SMART
FN3 899 981 2.36e-12 SMART
FN3 997 1084 1.64e-6 SMART
FN3 1101 1188 8.83e-12 SMART
FN3 1204 1289 3.62e-8 SMART
FN3 1305 1388 1.74e-10 SMART
FN3 1404 1489 8.23e-12 SMART
FN3 1506 1612 3.62e-8 SMART
FN3 1628 1713 1.15e-10 SMART
FN3 1728 1815 2.17e-11 SMART
FN3 1829 1913 5.04e-7 SMART
transmembrane domain 1935 1957 N/A INTRINSIC
low complexity region 2138 2153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125879
Meta Mutation Damage Score 0.1015 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 92% (96/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik G A 8: 106,436,412 (GRCm39) V194I probably benign Het
Acsm1 A T 7: 119,235,678 (GRCm39) I133F probably damaging Het
Adamts9 T A 6: 92,774,986 (GRCm39) T1676S probably benign Het
Adcy4 T C 14: 56,009,745 (GRCm39) D769G probably benign Het
Aif1 T C 17: 35,390,085 (GRCm39) *148W probably null Het
Akna C T 4: 63,310,363 (GRCm39) probably benign Het
Arhgap32 G A 9: 32,156,551 (GRCm39) probably null Het
Atpaf1 G A 4: 115,642,449 (GRCm39) E92K possibly damaging Het
Bltp2 T C 11: 78,159,203 (GRCm39) V467A possibly damaging Het
C1s1 T C 6: 124,510,313 (GRCm39) E378G probably benign Het
Caprin1 T A 2: 103,599,914 (GRCm39) Q108L probably damaging Het
Car13 A T 3: 14,721,299 (GRCm39) H154L probably benign Het
Cdon C A 9: 35,381,426 (GRCm39) N605K probably damaging Het
Ceacam10 G A 7: 24,480,439 (GRCm39) G70E probably damaging Het
Cfap221 G A 1: 119,881,930 (GRCm39) T286M probably benign Het
Cfap61 T C 2: 145,791,864 (GRCm39) F107S possibly damaging Het
Coil C A 11: 88,872,449 (GRCm39) T270N probably benign Het
Crocc2 T G 1: 93,151,936 (GRCm39) probably benign Het
Crot T C 5: 9,019,959 (GRCm39) E461G probably damaging Het
D130052B06Rik G T 11: 33,573,391 (GRCm39) R41L unknown Het
D630045J12Rik T C 6: 38,173,671 (GRCm39) S166G possibly damaging Het
Dennd4a T G 9: 64,769,673 (GRCm39) V460G probably damaging Het
Depdc7 A T 2: 104,557,668 (GRCm39) probably benign Het
Dgkb G A 12: 38,240,134 (GRCm39) probably null Het
Dhx57 T G 17: 80,582,226 (GRCm39) S407R probably benign Het
Dnase2a G T 8: 85,636,392 (GRCm39) probably benign Het
Dqx1 T G 6: 83,035,986 (GRCm39) M106R probably benign Het
Eno1b T C 18: 48,180,806 (GRCm39) I328T probably benign Het
Ephx2 T G 14: 66,345,512 (GRCm39) I151L probably benign Het
Gdf3 C T 6: 122,584,094 (GRCm39) G91D probably damaging Het
Gpc5 T A 14: 115,665,620 (GRCm39) N481K possibly damaging Het
Gsdme T A 6: 50,198,087 (GRCm39) H291L probably benign Het
H2-T13 A G 17: 36,394,614 (GRCm39) I103T possibly damaging Het
Hif3a G A 7: 16,785,946 (GRCm39) probably benign Het
Hmox2 A T 16: 4,583,627 (GRCm39) I232L probably benign Het
Itgb2 A G 10: 77,397,023 (GRCm39) Y686C probably damaging Het
Jmjd1c A G 10: 67,055,302 (GRCm39) T528A possibly damaging Het
Kdr T C 5: 76,121,388 (GRCm39) I541V possibly damaging Het
Khdrbs2 C A 1: 32,559,054 (GRCm39) V343L probably damaging Het
Kif16b C T 2: 142,695,579 (GRCm39) R175H probably damaging Het
Klri2 T G 6: 129,717,251 (GRCm39) E44A possibly damaging Het
Kmt2b G T 7: 30,276,180 (GRCm39) T1773K probably damaging Het
Lair1 A G 7: 4,013,785 (GRCm39) L154P probably damaging Het
Larp1b G A 3: 40,924,996 (GRCm39) V158M probably damaging Het
Lgi3 T A 14: 70,772,280 (GRCm39) I275N probably damaging Het
Lrba A G 3: 86,202,486 (GRCm39) N246D probably damaging Het
Lrrc45 T A 11: 120,605,733 (GRCm39) probably benign Het
Mdh2 G T 5: 135,818,533 (GRCm39) V263L probably benign Het
Myom1 T A 17: 71,341,688 (GRCm39) V149E probably damaging Het
Nanos1 A T 19: 60,745,479 (GRCm39) D259V probably damaging Het
Nedd4l T A 18: 65,294,725 (GRCm39) probably benign Het
Npas3 A G 12: 53,878,528 (GRCm39) Y150C probably damaging Het
Or10ab4 A T 7: 107,655,170 (GRCm39) H327L probably benign Het
Or10ag59 T A 2: 87,405,911 (GRCm39) V161D possibly damaging Het
Or2h1b C T 17: 37,462,446 (GRCm39) C139Y probably damaging Het
Or2y1f A T 11: 49,184,165 (GRCm39) I6F probably benign Het
Or52e15 G A 7: 104,645,913 (GRCm39) A66V probably damaging Het
Or8k28 T C 2: 86,286,363 (GRCm39) N84S possibly damaging Het
Pde4c A G 8: 71,202,725 (GRCm39) N637S probably benign Het
Pds5b T A 5: 150,702,740 (GRCm39) V824D possibly damaging Het
Pole2 A T 12: 69,269,160 (GRCm39) probably benign Het
Ppig C T 2: 69,566,320 (GRCm39) probably benign Het
Prep A G 10: 44,968,772 (GRCm39) Y90C probably damaging Het
Proca1 A T 11: 78,085,731 (GRCm39) R11S probably damaging Het
Prph T A 15: 98,954,872 (GRCm39) W313R probably benign Het
Prune2 C T 19: 17,100,444 (GRCm39) P1983S probably benign Het
Ptbp2 G A 3: 119,517,847 (GRCm39) probably benign Het
Rsph6a C T 7: 18,808,031 (GRCm39) P398L probably damaging Het
Sf3b1 C T 1: 55,058,430 (GRCm39) G53E probably damaging Het
Slc9a3 T C 13: 74,305,903 (GRCm39) probably null Het
Smarcal1 A T 1: 72,665,632 (GRCm39) H710L probably benign Het
Soat2 GAGAAG GAG 15: 102,059,142 (GRCm39) probably benign Het
Sptan1 T C 2: 29,881,045 (GRCm39) V438A probably damaging Het
Sstr4 T A 2: 148,238,181 (GRCm39) V264D probably damaging Het
Susd2 A G 10: 75,475,745 (GRCm39) L418P probably damaging Het
Synj1 A G 16: 90,735,528 (GRCm39) V1475A probably benign Het
Szt2 G A 4: 118,233,544 (GRCm39) probably benign Het
Tbc1d4 T C 14: 101,695,499 (GRCm39) probably null Het
Tesk1 A G 4: 43,446,000 (GRCm39) E311G probably damaging Het
Tmed5 A T 5: 108,273,882 (GRCm39) V119E probably damaging Het
Tmem260 T C 14: 48,724,324 (GRCm39) S201P possibly damaging Het
Tnxb A G 17: 34,890,707 (GRCm39) Y350C probably damaging Het
Tpte T C 8: 22,825,624 (GRCm39) probably benign Het
Trim37 A T 11: 87,037,794 (GRCm39) D161V probably damaging Het
Trrap C A 5: 144,751,366 (GRCm39) Q1640K probably damaging Het
Tspoap1 T C 11: 87,667,172 (GRCm39) probably benign Het
Ttk T A 9: 83,729,313 (GRCm39) probably benign Het
Vmn1r172 A G 7: 23,359,957 (GRCm39) S281G probably benign Het
Vmn1r177 A G 7: 23,565,022 (GRCm39) S285P probably damaging Het
Vmn1r231 C T 17: 21,110,661 (GRCm39) V85I probably damaging Het
Vmn2r100 C A 17: 19,742,382 (GRCm39) P252Q possibly damaging Het
Vmn2r118 T C 17: 55,915,643 (GRCm39) I436V probably benign Het
Vmn2r12 T C 5: 109,240,765 (GRCm39) K116R probably benign Het
Vmn2r28 T A 7: 5,491,513 (GRCm39) I245L probably benign Het
Wdr26 A T 1: 181,008,216 (GRCm39) probably benign Het
Xrcc3 A T 12: 111,776,391 (GRCm39) H67Q probably benign Het
Zbbx A T 3: 74,985,802 (GRCm39) S417T possibly damaging Het
Zc3h13 A G 14: 75,560,922 (GRCm39) D504G unknown Het
Zfp1005 G A 2: 150,109,973 (GRCm39) G221D probably damaging Het
Zfp217 C T 2: 169,957,382 (GRCm39) A539T probably benign Het
Zyg11b A T 4: 108,112,505 (GRCm39) F388I probably damaging Het
Other mutations in Sdk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Sdk2 APN 11 113,745,210 (GRCm39) missense possibly damaging 0.86
IGL01063:Sdk2 APN 11 113,721,668 (GRCm39) missense probably damaging 1.00
IGL01291:Sdk2 APN 11 113,733,906 (GRCm39) missense probably benign
IGL01316:Sdk2 APN 11 113,758,791 (GRCm39) missense probably benign 0.09
IGL01614:Sdk2 APN 11 113,684,684 (GRCm39) missense probably damaging 1.00
IGL01998:Sdk2 APN 11 113,729,358 (GRCm39) missense probably damaging 0.98
IGL02014:Sdk2 APN 11 113,729,320 (GRCm39) missense probably damaging 1.00
IGL02095:Sdk2 APN 11 113,725,656 (GRCm39) missense probably damaging 1.00
IGL02115:Sdk2 APN 11 113,725,639 (GRCm39) splice site probably benign
IGL02543:Sdk2 APN 11 113,759,747 (GRCm39) missense possibly damaging 0.90
IGL02976:Sdk2 APN 11 113,742,668 (GRCm39) missense probably damaging 1.00
IGL03001:Sdk2 APN 11 113,712,452 (GRCm39) missense probably benign 0.00
IGL03122:Sdk2 APN 11 113,732,894 (GRCm39) missense probably damaging 1.00
IGL03183:Sdk2 APN 11 113,741,810 (GRCm39) missense probably benign 0.19
IGL03222:Sdk2 APN 11 113,729,257 (GRCm39) missense probably benign 0.01
IGL03310:Sdk2 APN 11 113,684,151 (GRCm39) missense possibly damaging 0.77
Curtailed UTSW 11 113,742,626 (GRCm39) missense probably damaging 1.00
Trimmed UTSW 11 113,747,522 (GRCm39) nonsense probably null
ANU05:Sdk2 UTSW 11 113,733,906 (GRCm39) missense probably benign
BB008:Sdk2 UTSW 11 113,784,267 (GRCm39) missense possibly damaging 0.79
BB018:Sdk2 UTSW 11 113,784,267 (GRCm39) missense possibly damaging 0.79
R0008:Sdk2 UTSW 11 113,747,581 (GRCm39) missense probably damaging 1.00
R0008:Sdk2 UTSW 11 113,747,581 (GRCm39) missense probably damaging 1.00
R0088:Sdk2 UTSW 11 113,717,912 (GRCm39) missense possibly damaging 0.74
R0096:Sdk2 UTSW 11 113,793,970 (GRCm39) splice site probably benign
R0386:Sdk2 UTSW 11 113,784,290 (GRCm39) missense probably damaging 0.96
R0409:Sdk2 UTSW 11 113,741,717 (GRCm39) splice site probably benign
R0416:Sdk2 UTSW 11 113,694,029 (GRCm39) missense probably damaging 1.00
R0456:Sdk2 UTSW 11 113,682,292 (GRCm39) missense possibly damaging 0.93
R0544:Sdk2 UTSW 11 113,671,836 (GRCm39) missense probably damaging 1.00
R0691:Sdk2 UTSW 11 113,685,746 (GRCm39) splice site probably null
R0711:Sdk2 UTSW 11 113,793,970 (GRCm39) splice site probably benign
R0717:Sdk2 UTSW 11 113,723,152 (GRCm39) missense probably damaging 1.00
R0780:Sdk2 UTSW 11 113,784,334 (GRCm39) missense probably benign 0.07
R0831:Sdk2 UTSW 11 113,723,084 (GRCm39) missense probably damaging 0.96
R0853:Sdk2 UTSW 11 113,712,241 (GRCm39) missense probably benign 0.00
R0865:Sdk2 UTSW 11 113,741,748 (GRCm39) missense probably benign 0.12
R0930:Sdk2 UTSW 11 113,729,271 (GRCm39) missense probably benign 0.01
R0964:Sdk2 UTSW 11 113,697,243 (GRCm39) splice site probably benign
R1051:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1052:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1054:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1055:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1077:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1079:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1115:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1186:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1187:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1337:Sdk2 UTSW 11 113,723,157 (GRCm39) missense possibly damaging 0.79
R1430:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1433:Sdk2 UTSW 11 113,685,871 (GRCm39) missense probably damaging 0.99
R1464:Sdk2 UTSW 11 113,720,906 (GRCm39) missense possibly damaging 0.86
R1464:Sdk2 UTSW 11 113,720,906 (GRCm39) missense possibly damaging 0.86
R1497:Sdk2 UTSW 11 113,784,401 (GRCm39) splice site probably benign
R1514:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1529:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1596:Sdk2 UTSW 11 113,729,435 (GRCm39) splice site probably benign
R1680:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1680:Sdk2 UTSW 11 113,682,262 (GRCm39) missense possibly damaging 0.47
R1770:Sdk2 UTSW 11 113,684,567 (GRCm39) missense probably benign 0.05
R1858:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1866:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1874:Sdk2 UTSW 11 113,725,782 (GRCm39) missense probably benign 0.00
R1899:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1905:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1907:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1913:Sdk2 UTSW 11 113,747,552 (GRCm39) missense possibly damaging 0.77
R1964:Sdk2 UTSW 11 113,671,843 (GRCm39) nonsense probably null
R2055:Sdk2 UTSW 11 113,741,780 (GRCm39) missense probably damaging 1.00
R2059:Sdk2 UTSW 11 113,745,158 (GRCm39) missense probably damaging 1.00
R2093:Sdk2 UTSW 11 113,833,948 (GRCm39) missense probably damaging 1.00
R2256:Sdk2 UTSW 11 113,721,620 (GRCm39) missense probably benign 0.44
R3720:Sdk2 UTSW 11 113,691,070 (GRCm39) missense probably damaging 1.00
R3795:Sdk2 UTSW 11 113,747,522 (GRCm39) nonsense probably null
R4037:Sdk2 UTSW 11 113,685,881 (GRCm39) missense probably damaging 1.00
R4171:Sdk2 UTSW 11 113,757,815 (GRCm39) splice site probably null
R4717:Sdk2 UTSW 11 113,745,195 (GRCm39) missense probably damaging 0.96
R4758:Sdk2 UTSW 11 113,717,880 (GRCm39) missense possibly damaging 0.87
R4857:Sdk2 UTSW 11 113,712,208 (GRCm39) nonsense probably null
R4924:Sdk2 UTSW 11 113,748,584 (GRCm39) missense probably damaging 1.00
R5015:Sdk2 UTSW 11 113,684,587 (GRCm39) missense probably damaging 1.00
R5171:Sdk2 UTSW 11 113,741,808 (GRCm39) missense probably benign 0.01
R5239:Sdk2 UTSW 11 113,758,859 (GRCm39) missense probably damaging 1.00
R5243:Sdk2 UTSW 11 113,715,912 (GRCm39) missense possibly damaging 0.76
R5279:Sdk2 UTSW 11 113,757,857 (GRCm39) missense probably benign 0.31
R5535:Sdk2 UTSW 11 113,833,984 (GRCm39) missense possibly damaging 0.80
R5634:Sdk2 UTSW 11 113,742,540 (GRCm39) missense probably damaging 1.00
R5637:Sdk2 UTSW 11 113,724,005 (GRCm39) missense probably damaging 1.00
R5726:Sdk2 UTSW 11 113,742,626 (GRCm39) missense probably damaging 1.00
R5793:Sdk2 UTSW 11 113,759,778 (GRCm39) missense possibly damaging 0.46
R5798:Sdk2 UTSW 11 113,717,942 (GRCm39) missense probably damaging 1.00
R5834:Sdk2 UTSW 11 113,745,099 (GRCm39) missense probably damaging 1.00
R5863:Sdk2 UTSW 11 113,725,810 (GRCm39) missense probably damaging 0.98
R5869:Sdk2 UTSW 11 113,742,708 (GRCm39) missense probably damaging 0.96
R5875:Sdk2 UTSW 11 113,720,885 (GRCm39) missense probably benign 0.00
R5953:Sdk2 UTSW 11 113,684,570 (GRCm39) missense probably damaging 1.00
R5991:Sdk2 UTSW 11 113,834,080 (GRCm39) missense probably damaging 0.97
R6018:Sdk2 UTSW 11 113,720,889 (GRCm39) missense probably benign 0.00
R6116:Sdk2 UTSW 11 113,745,190 (GRCm39) missense probably damaging 0.99
R6328:Sdk2 UTSW 11 113,684,581 (GRCm39) missense probably damaging 1.00
R6348:Sdk2 UTSW 11 113,784,334 (GRCm39) missense probably benign 0.07
R6383:Sdk2 UTSW 11 113,723,091 (GRCm39) missense probably damaging 1.00
R6824:Sdk2 UTSW 11 113,758,760 (GRCm39) missense probably benign 0.43
R6835:Sdk2 UTSW 11 113,720,874 (GRCm39) missense probably damaging 0.98
R6853:Sdk2 UTSW 11 113,671,755 (GRCm39) missense probably damaging 0.99
R6912:Sdk2 UTSW 11 113,793,946 (GRCm39) missense probably benign 0.03
R7000:Sdk2 UTSW 11 113,693,995 (GRCm39) missense probably damaging 1.00
R7099:Sdk2 UTSW 11 113,725,731 (GRCm39) missense probably damaging 0.98
R7102:Sdk2 UTSW 11 113,733,516 (GRCm39) nonsense probably null
R7177:Sdk2 UTSW 11 113,720,795 (GRCm39) missense possibly damaging 0.91
R7381:Sdk2 UTSW 11 113,729,315 (GRCm39) missense probably damaging 0.98
R7412:Sdk2 UTSW 11 113,758,909 (GRCm39) splice site probably null
R7504:Sdk2 UTSW 11 113,758,793 (GRCm39) missense possibly damaging 0.50
R7552:Sdk2 UTSW 11 113,764,039 (GRCm39) missense possibly damaging 0.63
R7604:Sdk2 UTSW 11 113,720,795 (GRCm39) missense possibly damaging 0.91
R7647:Sdk2 UTSW 11 113,684,563 (GRCm39) missense probably damaging 1.00
R7897:Sdk2 UTSW 11 113,764,027 (GRCm39) missense possibly damaging 0.50
R7931:Sdk2 UTSW 11 113,784,267 (GRCm39) missense possibly damaging 0.79
R7998:Sdk2 UTSW 11 113,750,764 (GRCm39) missense probably benign 0.18
R8052:Sdk2 UTSW 11 113,745,177 (GRCm39) missense probably damaging 1.00
R8053:Sdk2 UTSW 11 113,745,177 (GRCm39) missense probably damaging 1.00
R8084:Sdk2 UTSW 11 113,717,915 (GRCm39) missense possibly damaging 0.67
R8136:Sdk2 UTSW 11 113,742,539 (GRCm39) missense probably damaging 1.00
R8151:Sdk2 UTSW 11 113,763,683 (GRCm39) missense possibly damaging 0.84
R8394:Sdk2 UTSW 11 113,729,542 (GRCm39) missense probably benign
R8715:Sdk2 UTSW 11 113,671,728 (GRCm39) missense probably damaging 1.00
R8774:Sdk2 UTSW 11 113,730,169 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Sdk2 UTSW 11 113,730,169 (GRCm39) missense probably damaging 1.00
R8804:Sdk2 UTSW 11 113,763,978 (GRCm39) nonsense probably null
R9136:Sdk2 UTSW 11 113,697,203 (GRCm39) missense probably damaging 1.00
R9147:Sdk2 UTSW 11 113,714,226 (GRCm39) missense probably benign 0.18
R9300:Sdk2 UTSW 11 113,715,856 (GRCm39) missense possibly damaging 0.63
R9354:Sdk2 UTSW 11 113,725,757 (GRCm39) missense probably benign 0.00
R9450:Sdk2 UTSW 11 113,697,105 (GRCm39) missense probably benign
R9462:Sdk2 UTSW 11 113,760,744 (GRCm39) missense possibly damaging 0.56
R9616:Sdk2 UTSW 11 113,691,061 (GRCm39) missense probably benign 0.05
R9678:Sdk2 UTSW 11 113,685,789 (GRCm39) nonsense probably null
RF002:Sdk2 UTSW 11 113,776,078 (GRCm39) missense probably benign 0.00
V1662:Sdk2 UTSW 11 113,725,734 (GRCm39) missense probably damaging 1.00
Z1176:Sdk2 UTSW 11 113,742,662 (GRCm39) missense probably damaging 0.97
Z1176:Sdk2 UTSW 11 113,730,148 (GRCm39) missense probably benign 0.41
Z1177:Sdk2 UTSW 11 113,750,782 (GRCm39) missense probably benign
Z1177:Sdk2 UTSW 11 113,730,146 (GRCm39) missense probably damaging 1.00
Z1177:Sdk2 UTSW 11 113,729,485 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACATGGCATGATCCCTTAGTGACC -3'
(R):5'- TGGACATCAAGCCCATTGGACAAG -3'

Sequencing Primer
(F):5'- ATGATCCCTTAGTGACCTTGAC -3'
(R):5'- TGTTGCTGCAACCACAGAG -3'
Posted On 2013-04-24