Incidental Mutation 'R4170:Olfr482'
ID320740
Institutional Source Beutler Lab
Gene Symbol Olfr482
Ensembl Gene ENSMUSG00000059031
Gene Nameolfactory receptor 482
SynonymsMOR204-14, GA_x6K02T2PBJ9-10424354-10423383
MMRRC Submission 040863-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R4170 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108092999-108097586 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108095073 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 166 (I166L)
Ref Sequence ENSEMBL: ENSMUSP00000150755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081184] [ENSMUST00000217304]
Predicted Effect probably benign
Transcript: ENSMUST00000081184
AA Change: I166L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000079948
Gene: ENSMUSG00000059031
AA Change: I166L

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1.2e-52 PFAM
Pfam:7tm_1 44 293 8.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207291
Predicted Effect probably benign
Transcript: ENSMUST00000217304
AA Change: I166L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700047A11Rik T A 8: 26,095,787 T63S probably benign Het
Acap3 T A 4: 155,900,001 S189T possibly damaging Het
Acsbg2 G A 17: 56,853,846 T266I probably benign Het
Cacna1s A G 1: 136,108,195 D1144G probably damaging Het
Diaph3 T C 14: 86,985,707 D365G probably damaging Het
Dock7 T A 4: 98,966,401 D1542V probably damaging Het
Efr3a T A 15: 65,845,982 V337D probably damaging Het
Elk3 A G 10: 93,265,335 probably null Het
Ercc6 T C 14: 32,566,797 L867P probably damaging Het
Gdf6 A G 4: 9,859,650 D244G probably benign Het
Gzmn T C 14: 56,166,804 D192G possibly damaging Het
Krt81 T A 15: 101,461,312 M242L probably benign Het
Lysmd3 C T 13: 81,669,410 Q169* probably null Het
Man2c1 A G 9: 57,138,026 D473G probably benign Het
Mmp23 C T 4: 155,651,310 R268Q probably damaging Het
Olfr346 C A 2: 36,688,722 T240N probably damaging Het
Prmt3 G T 7: 49,826,776 A378S probably benign Het
Ptf1a C T 2: 19,447,008 L273F possibly damaging Het
Ptpru A T 4: 131,776,348 Y1124N probably damaging Het
Rtkn T G 6: 83,142,395 M1R probably null Het
Rttn T A 18: 88,975,723 F175I probably damaging Het
Slc5a7 T C 17: 54,276,858 D468G probably benign Het
Slc9a9 A G 9: 95,228,899 Y590C probably damaging Het
Smarcd1 T C 15: 99,707,931 L320P probably damaging Het
Sox2 A T 3: 34,650,554 M47L probably damaging Het
Sptan1 T C 2: 30,030,025 M2258T possibly damaging Het
Tnrc6b T A 15: 80,916,787 D1431E probably benign Het
Trav8n-2 A T 14: 53,346,418 T111S possibly damaging Het
Wrb G A 16: 96,152,976 A92T probably benign Het
Zbtb46 T C 2: 181,424,355 M1V probably null Het
Zcchc11 A G 4: 108,548,059 Y1293C probably damaging Het
Zfp7 T C 15: 76,891,618 V620A probably benign Het
Zfp804a T A 2: 82,253,488 F95I probably damaging Het
Other mutations in Olfr482
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Olfr482 APN 7 108094839 missense probably damaging 1.00
IGL01482:Olfr482 APN 7 108095486 missense probably benign 0.01
IGL01710:Olfr482 APN 7 108095242 missense probably benign 0.00
IGL02064:Olfr482 APN 7 108095247 missense probably benign 0.20
IGL02930:Olfr482 APN 7 108095414 missense probably damaging 1.00
IGL03206:Olfr482 APN 7 108095054 missense probably damaging 1.00
IGL03255:Olfr482 APN 7 108094817 missense probably damaging 1.00
R0378:Olfr482 UTSW 7 108095222 missense probably benign 0.10
R0552:Olfr482 UTSW 7 108094778 missense probably benign 0.01
R1538:Olfr482 UTSW 7 108095286 missense probably damaging 1.00
R1771:Olfr482 UTSW 7 108095609 splice site probably null
R1939:Olfr482 UTSW 7 108095141 missense probably benign 0.06
R2258:Olfr482 UTSW 7 108095195 missense possibly damaging 0.95
R4169:Olfr482 UTSW 7 108095384 missense probably damaging 1.00
R4485:Olfr482 UTSW 7 108095015 missense probably benign
R4803:Olfr482 UTSW 7 108095459 missense probably damaging 0.99
R4887:Olfr482 UTSW 7 108095096 missense probably benign 0.18
R5059:Olfr482 UTSW 7 108095315 missense probably damaging 1.00
R5445:Olfr482 UTSW 7 108094742 missense possibly damaging 0.69
R5539:Olfr482 UTSW 7 108095226 missense probably benign 0.23
R5644:Olfr482 UTSW 7 108094804 nonsense probably null
R6200:Olfr482 UTSW 7 108095525 frame shift probably null
R7171:Olfr482 UTSW 7 108095135 missense probably benign 0.00
R8024:Olfr482 UTSW 7 108095289 missense probably benign 0.19
X0021:Olfr482 UTSW 7 108094959 missense probably benign 0.20
Z1176:Olfr482 UTSW 7 108094994 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGCATCTTCAGGACAGTG -3'
(R):5'- TGTTCTATACAGTTCGGCTCAGC -3'

Sequencing Primer
(F):5'- CGCATCTTCAGGACAGTGATGAG -3'
(R):5'- GGCTCAGCTACTTTCTTTGGAGTAC -3'
Posted On2015-06-12