Incidental Mutation 'R4170:Slc9a9'
ID320744
Institutional Source Beutler Lab
Gene Symbol Slc9a9
Ensembl Gene ENSMUSG00000031129
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 9
Synonyms5730527A11Rik, Nhe9
MMRRC Submission 040863-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4170 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location94669909-95230445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95228899 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 590 (Y590C)
Ref Sequence ENSEMBL: ENSMUSP00000033463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033463]
Predicted Effect probably damaging
Transcript: ENSMUST00000033463
AA Change: Y590C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033463
Gene: ENSMUSG00000031129
AA Change: Y590C

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 28 486 2.6e-89 PFAM
low complexity region 594 600 N/A INTRINSIC
low complexity region 621 635 N/A INTRINSIC
Meta Mutation Damage Score 0.1887 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium/proton exchanger that is a member of the solute carrier 9 protein family. The encoded protein localizes the to the late recycling endosomes and may play an important role in maintaining cation homeostasis. Mutations in this gene are associated with autism susceptibility 16 and attention-deficit/hyperactivity disorder. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700047A11Rik T A 8: 26,095,787 T63S probably benign Het
Acap3 T A 4: 155,900,001 S189T possibly damaging Het
Acsbg2 G A 17: 56,853,846 T266I probably benign Het
Cacna1s A G 1: 136,108,195 D1144G probably damaging Het
Diaph3 T C 14: 86,985,707 D365G probably damaging Het
Dock7 T A 4: 98,966,401 D1542V probably damaging Het
Efr3a T A 15: 65,845,982 V337D probably damaging Het
Elk3 A G 10: 93,265,335 probably null Het
Ercc6 T C 14: 32,566,797 L867P probably damaging Het
Gdf6 A G 4: 9,859,650 D244G probably benign Het
Gzmn T C 14: 56,166,804 D192G possibly damaging Het
Krt81 T A 15: 101,461,312 M242L probably benign Het
Lysmd3 C T 13: 81,669,410 Q169* probably null Het
Man2c1 A G 9: 57,138,026 D473G probably benign Het
Mmp23 C T 4: 155,651,310 R268Q probably damaging Het
Olfr346 C A 2: 36,688,722 T240N probably damaging Het
Olfr482 T A 7: 108,095,073 I166L probably benign Het
Prmt3 G T 7: 49,826,776 A378S probably benign Het
Ptf1a C T 2: 19,447,008 L273F possibly damaging Het
Ptpru A T 4: 131,776,348 Y1124N probably damaging Het
Rtkn T G 6: 83,142,395 M1R probably null Het
Rttn T A 18: 88,975,723 F175I probably damaging Het
Slc5a7 T C 17: 54,276,858 D468G probably benign Het
Smarcd1 T C 15: 99,707,931 L320P probably damaging Het
Sox2 A T 3: 34,650,554 M47L probably damaging Het
Sptan1 T C 2: 30,030,025 M2258T possibly damaging Het
Tnrc6b T A 15: 80,916,787 D1431E probably benign Het
Trav8n-2 A T 14: 53,346,418 T111S possibly damaging Het
Wrb G A 16: 96,152,976 A92T probably benign Het
Zbtb46 T C 2: 181,424,355 M1V probably null Het
Zcchc11 A G 4: 108,548,059 Y1293C probably damaging Het
Zfp7 T C 15: 76,891,618 V620A probably benign Het
Zfp804a T A 2: 82,253,488 F95I probably damaging Het
Other mutations in Slc9a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Slc9a9 APN 9 95055459 missense probably benign 0.03
IGL01394:Slc9a9 APN 9 95123037 missense probably benign
IGL01434:Slc9a9 APN 9 95019194 missense possibly damaging 0.49
IGL01715:Slc9a9 APN 9 94960446 missense probably damaging 1.00
IGL01821:Slc9a9 APN 9 95228950 missense probably benign
IGL02963:Slc9a9 APN 9 95020714 critical splice donor site probably null
IGL03211:Slc9a9 APN 9 95137990 splice site probably benign
ANU18:Slc9a9 UTSW 9 95055459 missense probably benign 0.03
R0306:Slc9a9 UTSW 9 95137934 missense probably benign
R0382:Slc9a9 UTSW 9 94685217 missense probably benign 0.18
R0388:Slc9a9 UTSW 9 94939563 critical splice donor site probably null
R1509:Slc9a9 UTSW 9 95228958 missense probably benign
R1785:Slc9a9 UTSW 9 95019193 missense possibly damaging 0.95
R4018:Slc9a9 UTSW 9 94685163 missense probably benign 0.03
R4167:Slc9a9 UTSW 9 95228899 missense probably damaging 0.98
R4695:Slc9a9 UTSW 9 94936449 critical splice donor site probably benign
R5400:Slc9a9 UTSW 9 94712901 missense probably damaging 1.00
R5609:Slc9a9 UTSW 9 94809937 missense probably damaging 1.00
R5684:Slc9a9 UTSW 9 95055508 missense possibly damaging 0.89
R6015:Slc9a9 UTSW 9 94939549 missense probably benign 0.29
R6102:Slc9a9 UTSW 9 94936429 missense probably benign 0.03
R6317:Slc9a9 UTSW 9 94939459 missense possibly damaging 0.51
R6398:Slc9a9 UTSW 9 94670227 missense probably benign 0.00
R6476:Slc9a9 UTSW 9 94685138 missense probably benign 0.00
R6501:Slc9a9 UTSW 9 94936371 missense probably benign 0.01
R6603:Slc9a9 UTSW 9 94939546 missense probably damaging 0.98
R6611:Slc9a9 UTSW 9 94939478 missense probably benign 0.18
R6700:Slc9a9 UTSW 9 94936311 missense possibly damaging 0.66
R6824:Slc9a9 UTSW 9 95227198 missense probably damaging 1.00
R6931:Slc9a9 UTSW 9 94670086 missense possibly damaging 0.73
R6975:Slc9a9 UTSW 9 94960446 missense probably damaging 1.00
R6987:Slc9a9 UTSW 9 94669990 start gained probably benign
R7325:Slc9a9 UTSW 9 94712898 missense probably benign 0.24
R7374:Slc9a9 UTSW 9 95055489 missense possibly damaging 0.90
R7437:Slc9a9 UTSW 9 95228941 missense probably benign 0.00
R7614:Slc9a9 UTSW 9 94855739 missense probably damaging 1.00
R8412:Slc9a9 UTSW 9 95229039 missense probably damaging 1.00
R8501:Slc9a9 UTSW 9 94855739 missense probably damaging 1.00
R8514:Slc9a9 UTSW 9 94936365 missense probably benign 0.01
X0010:Slc9a9 UTSW 9 94685208 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GTATGTCTGTGTGCCATATACAC -3'
(R):5'- GTTGGCATTCCTCAGTGGTC -3'

Sequencing Primer
(F):5'- TGTGCCATATACACAAAACATTCC -3'
(R):5'- GTGATTAAGTCTGCACTCATCATACC -3'
Posted On2015-06-12