Incidental Mutation 'R4170:Elk3'
ID320745
Institutional Source Beutler Lab
Gene Symbol Elk3
Ensembl Gene ENSMUSG00000008398
Gene NameELK3, member of ETS oncogene family
SynonymsNet, D430049E23Rik, Erp, Sap-2
MMRRC Submission 040863-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.437) question?
Stock #R4170 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location93247414-93311135 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 93265335 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008542] [ENSMUST00000129827] [ENSMUST00000151153] [ENSMUST00000215286] [ENSMUST00000223340]
Predicted Effect probably damaging
Transcript: ENSMUST00000008542
AA Change: F185L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000008542
Gene: ENSMUSG00000008398
AA Change: F185L

DomainStartEndE-ValueType
ETS 4 89 1.56e-55 SMART
low complexity region 200 222 N/A INTRINSIC
low complexity region 229 256 N/A INTRINSIC
low complexity region 278 299 N/A INTRINSIC
low complexity region 356 367 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129827
SMART Domains Protein: ENSMUSP00000122324
Gene: ENSMUSG00000008398

DomainStartEndE-ValueType
ETS 4 89 1.56e-55 SMART
low complexity region 200 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151153
SMART Domains Protein: ENSMUSP00000121754
Gene: ENSMUSG00000008398

DomainStartEndE-ValueType
ETS 4 80 7.6e-36 SMART
low complexity region 89 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215286
Predicted Effect probably benign
Transcript: ENSMUST00000216729
Predicted Effect probably null
Transcript: ENSMUST00000223340
Meta Mutation Damage Score 0.2380 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ETS-domain transcription factor family and the ternary complex factor (TCF) subfamily. Proteins in this subfamily regulate transcription when recruited by serum response factor to bind to serum response elements. This protein is activated by signal-induced phosphorylation; studies in rodents suggest that it is a transcriptional inhibitor in the absence of Ras, but activates transcription when Ras is present. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for a null allele develop a vascular defect associated with lymphangiectasis and die prematurely due to respiratory failure resulting from chylothorax. Homozygotes for a different null allele show a transient delay in retinal primary plexus vascularization and tortuous retinal arteries. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700047A11Rik T A 8: 26,095,787 T63S probably benign Het
Acap3 T A 4: 155,900,001 S189T possibly damaging Het
Acsbg2 G A 17: 56,853,846 T266I probably benign Het
Cacna1s A G 1: 136,108,195 D1144G probably damaging Het
Diaph3 T C 14: 86,985,707 D365G probably damaging Het
Dock7 T A 4: 98,966,401 D1542V probably damaging Het
Efr3a T A 15: 65,845,982 V337D probably damaging Het
Ercc6 T C 14: 32,566,797 L867P probably damaging Het
Gdf6 A G 4: 9,859,650 D244G probably benign Het
Gzmn T C 14: 56,166,804 D192G possibly damaging Het
Krt81 T A 15: 101,461,312 M242L probably benign Het
Lysmd3 C T 13: 81,669,410 Q169* probably null Het
Man2c1 A G 9: 57,138,026 D473G probably benign Het
Mmp23 C T 4: 155,651,310 R268Q probably damaging Het
Olfr346 C A 2: 36,688,722 T240N probably damaging Het
Olfr482 T A 7: 108,095,073 I166L probably benign Het
Prmt3 G T 7: 49,826,776 A378S probably benign Het
Ptf1a C T 2: 19,447,008 L273F possibly damaging Het
Ptpru A T 4: 131,776,348 Y1124N probably damaging Het
Rtkn T G 6: 83,142,395 M1R probably null Het
Rttn T A 18: 88,975,723 F175I probably damaging Het
Slc5a7 T C 17: 54,276,858 D468G probably benign Het
Slc9a9 A G 9: 95,228,899 Y590C probably damaging Het
Smarcd1 T C 15: 99,707,931 L320P probably damaging Het
Sox2 A T 3: 34,650,554 M47L probably damaging Het
Sptan1 T C 2: 30,030,025 M2258T possibly damaging Het
Tnrc6b T A 15: 80,916,787 D1431E probably benign Het
Trav8n-2 A T 14: 53,346,418 T111S possibly damaging Het
Wrb G A 16: 96,152,976 A92T probably benign Het
Zbtb46 T C 2: 181,424,355 M1V probably null Het
Zcchc11 A G 4: 108,548,059 Y1293C probably damaging Het
Zfp7 T C 15: 76,891,618 V620A probably benign Het
Zfp804a T A 2: 82,253,488 F95I probably damaging Het
Other mutations in Elk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Elk3 APN 10 93284827 missense probably damaging 1.00
IGL02566:Elk3 APN 10 93265463 missense probably damaging 1.00
IGL03251:Elk3 APN 10 93254821 splice site probably null
R0308:Elk3 UTSW 10 93265205 missense probably benign
R0594:Elk3 UTSW 10 93265160 missense probably damaging 1.00
R0601:Elk3 UTSW 10 93265481 missense probably damaging 0.98
R1190:Elk3 UTSW 10 93265196 missense probably benign 0.00
R2021:Elk3 UTSW 10 93265677 missense probably damaging 1.00
R2022:Elk3 UTSW 10 93265677 missense probably damaging 1.00
R2418:Elk3 UTSW 10 93284827 missense probably damaging 1.00
R3935:Elk3 UTSW 10 93265173 missense possibly damaging 0.60
R4167:Elk3 UTSW 10 93265335 critical splice donor site probably null
R4168:Elk3 UTSW 10 93265335 critical splice donor site probably null
R4169:Elk3 UTSW 10 93265335 critical splice donor site probably null
R5864:Elk3 UTSW 10 93284791 missense probably damaging 1.00
R6171:Elk3 UTSW 10 93250044 missense probably damaging 1.00
R6743:Elk3 UTSW 10 93265050 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TCCAGGAAGAGGCTTCTGTG -3'
(R):5'- TCTCTCAAAAGTGCCAGCC -3'

Sequencing Primer
(F):5'- CAGGAAGAGGCTTCTGTGTTCAG -3'
(R):5'- GCCGCAACGAGTACCTC -3'
Posted On2015-06-12