Incidental Mutation 'R4170:Gzmn'
ID320749
Institutional Source Beutler Lab
Gene Symbol Gzmn
Ensembl Gene ENSMUSG00000015443
Gene Namegranzyme N
SynonymsGrN
MMRRC Submission 040863-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R4170 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location56165797-56174599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56166804 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 192 (D192G)
Ref Sequence ENSEMBL: ENSMUSP00000015587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015587] [ENSMUST00000225535]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015587
AA Change: D192G

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000015587
Gene: ENSMUSG00000015443
AA Change: D192G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 20 241 5.89e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224928
Predicted Effect possibly damaging
Transcript: ENSMUST00000225535
AA Change: D192G

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700047A11Rik T A 8: 26,095,787 T63S probably benign Het
Acap3 T A 4: 155,900,001 S189T possibly damaging Het
Acsbg2 G A 17: 56,853,846 T266I probably benign Het
Cacna1s A G 1: 136,108,195 D1144G probably damaging Het
Diaph3 T C 14: 86,985,707 D365G probably damaging Het
Dock7 T A 4: 98,966,401 D1542V probably damaging Het
Efr3a T A 15: 65,845,982 V337D probably damaging Het
Elk3 A G 10: 93,265,335 probably null Het
Ercc6 T C 14: 32,566,797 L867P probably damaging Het
Gdf6 A G 4: 9,859,650 D244G probably benign Het
Krt81 T A 15: 101,461,312 M242L probably benign Het
Lysmd3 C T 13: 81,669,410 Q169* probably null Het
Man2c1 A G 9: 57,138,026 D473G probably benign Het
Mmp23 C T 4: 155,651,310 R268Q probably damaging Het
Olfr346 C A 2: 36,688,722 T240N probably damaging Het
Olfr482 T A 7: 108,095,073 I166L probably benign Het
Prmt3 G T 7: 49,826,776 A378S probably benign Het
Ptf1a C T 2: 19,447,008 L273F possibly damaging Het
Ptpru A T 4: 131,776,348 Y1124N probably damaging Het
Rtkn T G 6: 83,142,395 M1R probably null Het
Rttn T A 18: 88,975,723 F175I probably damaging Het
Slc5a7 T C 17: 54,276,858 D468G probably benign Het
Slc9a9 A G 9: 95,228,899 Y590C probably damaging Het
Smarcd1 T C 15: 99,707,931 L320P probably damaging Het
Sox2 A T 3: 34,650,554 M47L probably damaging Het
Sptan1 T C 2: 30,030,025 M2258T possibly damaging Het
Tnrc6b T A 15: 80,916,787 D1431E probably benign Het
Trav8n-2 A T 14: 53,346,418 T111S possibly damaging Het
Wrb G A 16: 96,152,976 A92T probably benign Het
Zbtb46 T C 2: 181,424,355 M1V probably null Het
Zcchc11 A G 4: 108,548,059 Y1293C probably damaging Het
Zfp7 T C 15: 76,891,618 V620A probably benign Het
Zfp804a T A 2: 82,253,488 F95I probably damaging Het
Other mutations in Gzmn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Gzmn APN 14 56166979 missense probably benign 0.06
IGL01638:Gzmn APN 14 56169019 missense probably benign 0.03
IGL02234:Gzmn APN 14 56169007 splice site probably null
IGL02691:Gzmn APN 14 56166913 missense probably benign 0.10
R0022:Gzmn UTSW 14 56166925 missense probably damaging 1.00
R1589:Gzmn UTSW 14 56165911 missense probably benign 0.05
R3763:Gzmn UTSW 14 56166904 missense probably benign 0.08
R4153:Gzmn UTSW 14 56167842 missense probably damaging 1.00
R4420:Gzmn UTSW 14 56166006 missense probably benign 0.03
R5215:Gzmn UTSW 14 56167862 missense probably damaging 1.00
R5307:Gzmn UTSW 14 56167946 missense probably damaging 0.99
R6727:Gzmn UTSW 14 56165975 missense probably damaging 0.99
R7644:Gzmn UTSW 14 56167319 missense probably damaging 1.00
X0023:Gzmn UTSW 14 56167350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAGTGACATCCAGCCCTG -3'
(R):5'- CCCAATCAGCTGGAGAGTAAGG -3'

Sequencing Primer
(F):5'- GACATCCAGCCCTGCCCTC -3'
(R):5'- ACTAGAGATGTGAGGCCCCTC -3'
Posted On2015-06-12